Regulation of the Human Cardiac/Slow-Twitch Troponin C Gene by Multiple, Cooperative, Cell-Type-Specific, and MyoD-Responsive Elements
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, Nov. 1993, p. 6752-6765 Vol. 13, No. 11
0270-7306/93/116752-14$02.00/0
Copyright X 1993, American Society for Microbiology
Regulation of the Human Cardiac/Slow-Twitch Troponin C
Gene by Multiple, Cooperative, Cell-Type-Specific, and
MyoD-Responsive Elements
THORKIL H. CHRISTENSEN, HOWARD PRENTICE, REINHOLD GAHLMANN,t
AND LARRY KEDES*
Institute for Genetic Medicine and Departments of Biochemistry and Medicine, University of
Southern California School of Medicine, Los Angeles, California 90033
Received 27 April 1993/Accepted 18 August 1993
The cardiac troponin C (cTnC) gene produces identical transcripts in slow-twitch skeletal muscle and in
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
heart muscle (R. Gahlmann, R. Wade, P. Gunning, and L. Kedes, J. Mol. Biol. 201:379-391, 1988). A
separate gene encodes the fast-twitch skeletal muscle troponin C and is not expressed in heart muscle. We have
used transient transfection to characterize the regulatory elements responsible for skeletal and cardiac
cell-type-specific expression of the human cTnC (HcTnC) gene. At least four separate elements cooperate to
confer tissue-specific expression of this gene in differentiated myotubes; a basal promoter (between -61 and
-13) augments transcription 9-fold, upstream major regulatory sequences (between -68 and -142 and
between -1319 and -4500) augment transcription as much as 39-fold, and at least two enhancer-like elements
in the first intron (between +58 and +1028 and between +1029 and +1523) independently augment
transcription 4- to 5-fold. These enhancers in the first intron increase myotube-specific chloramphenicol
acetyltransferase activity when linked to their own promoter elements or to the heterologous simian virus 40
promoter, and the effects are multiplicative rather than additive. Each of the major myotube regulatory regions
is capable of responding directly or indirectly to the myogenic determination factor, MyoD. A MyoD expression
vector in 1OT1/2 cells induced constructs carrying either the upstream HcTnC promoter elements or the first
intron of the gene 300- to 500-fold. Expression was inhibited by cotransfection with Id, a negative regulator of
basic helix-loop-helix transcription factors. The basal promoter contains five tandem TGGGC repeats that
interact with Spl or an Spl-like factor in nuclear extracts. Mutational analysis of this element demonstrated
that two of the five repeat sequences were sufficient to support basal level muscle cell-specific transcription.
Whereas the basal promoter is also critical for expression in cardiac myocytes, the elements upstream of -67
appear to play little or no role. Major augmentation of expression in cardiomyocytes is also provided by
sequences in the first intron, but these are upstream (between +58 and +1028). The downstream segment of
the first intron has no enhancer activity in cardiomyocytes. A specific DNA-protein complex is formed by this
C2 cell enhancer with extracts from C2 cells but not cardiomyocytes. These observations suggest that
tissue-specific expression of the HcTnC gene is cooperatively regulated by the complex interactions of multiple
regulatory elements and that different elements are used to regulate expression in myogenic and cardiac cells.
Development of muscle structure and function requires suggests the physiologic relevance of fiber-type-specific ex-
the coordinated expression of an array of muscle-specific pression of these two isoforms of TnC; the two proteins have
genes (for a review, see reference 5). Study of the genes for different characteristics that influence contractile properties,
striated muscle contractile proteins has proven useful for the including the length-induced autoregulation of myocardial
elucidation of mechanisms responsible for tissue-specific contraction (3, 61).
gene expression (95). Because the troponin family of genes is We have been examining the mechanisms of tissue-spe-
expressed only in striated muscles (there are no known cific regulation of the human TnC fast-twitch (HTnCf) and
smooth muscle or nonmuscle isoforms [74]), they constitute slow-twitch (HcTnC) genes and have previously reported
an excellent model system for study of highly restricted their cloning, structure, and initial functional analyses (19,
regulation. The three troponins, troponin I (TnI), TnT, and 20, 32, 87). The mechanisms for the differential expression of
TnC, are members of evolutionary distinct and unrelated these two genes appear distinctive. The fast-twitch gene
gene families (14). They encode the functionally interacting requires the presence of both an upstream element and a
subunits of the calcium regulatory troponin complex of proximal promoter (33). In contrast, basal expression of
vertebrate striated muscle (71). In the case of TnC, the cTnC in myogenic cells requires only a positively acting
calcium-binding subunit of the complex, there is a fast- short promoter located within the first 67 bp of the 5' flanking
twitch skeletal muscle gene (TnCf) and a second gene (cTnC, sequence (87). Although many of the same tissue-specific
previously designated sTnC [slow-twitch troponin C]) ex- genes are expressed in both skeletal and cardiac myocytes,
pressed in both slow-twitch skeletal muscle and cardiac including cTnC, it remains to be determined how similar are
muscle (27, 34, 72a, 101). A considerable body of evidence the transcriptional regulatory mechanisms responsible for
the production of the cardiac and skeletal muscle pheno-
*
Corresponding author. types (reviewed in reference 84). In fact, the best-character-
t Present address: Institute of Industrial Toxicology, Bayer AG, ized myogenic regulatory factors, the members of the MyoD
5600 Wuppertal 1, Germany. family of basic region-helix-loop-helix (bHLH) proteins (70,
6752VOL. 13, 1993 CARDIAC TROPONIN C 6753
79, 97), are not expressed in cardiomyocytes. Thus, it is A
useful to determine whether the activation of genes such as -450 JiF- L oHTnCs4500CAT/11
the cTnC gene requires the same or different sets of tran-
scriptional elements. Indeed, many muscle-specific genes -1318 1 pHTnCsl318CAT/11
use combinations of both specific and ubiquitous factors to
regulate high-level muscle-specific transcription (16, 36, 54, -714 pHTnCs714CAT
66, 67, 85; reviewed in reference 5). -538 I pHTnCsS38CAT
In this study, we used transient transfection assays and
400 pHTnCs400CAT
nuclear protein binding assays to identify the cis-acting
sequences that regulate such high-level cell-type-specific -22 pHTnCs225CAT
cTnC expression. We tested the expression of a nested set of -142 CAT - pHTnCsl42CAT
HcTnC upstream sequences, with or without segments of
the first intron, linked to the chloramphenicol acetyltrans- -67 pHTnCs67CAT/11
ferase (CAT) gene in muscle and nonmuscle cell lines, in
primary neonatal cardiomyocytes, and in 10T1/2 cells SV40 1 1 pSV40CAT/Il
cotransfected with MyoD. The results of these experiments
led to the discovery in this gene of at least four regions that B
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
are relevant to skeletal muscle cell-type-specific transcrip-
tion: a basal promoter (from -13 to -61), two or more a IVS
1
upstream regulatory sequences (from -61 to -142 and from 52 1500 1523
-1318 to =-4500), and at least two distinct enhancers in the
first intron. The combinatorial interactions of dispersed 52 lOOOL 1028
elements of the HcTnC gene are directly or indirectly 541 1000 1523
responsive to MyoD and regulate the expression of this key
contractile protein gene. In primary cardiomyocytes, how- 1029 50 1523
ever, sequences upstream of the basal promoter at -67
appear to play no major role. Furthermore, the region of the FIG. 1. Schematic maps of HcTnC and SV40 promoter plasmid
first intron containing one but not both of the muscle constructs. Construction of the chimeric plasmids is described in
enhancer elements appears to provide the major activation in Materials and Methods. Numbers at the left indicate the base pairs
of HcTnC DNA that are included in the constructs upstream from
cardiomyocytes. While this report was in preparation, Par- the start site of transcription (right-angled arrows). Plasmid desig-
macek et al. (73) reported the results of studies on the nations are shown at the right. The designation /11 and the two-
regulation of expression of the mouse homolog to the human headed arrows indicate additional constructs that also contain
cTnC gene, using methods similar to those reported here. various segments of the HcTnC first intron inserted in both orien-
Similarities as well as significant differences in the organiza- tations downstream from the CAT gene.
tion of regulatory elements of the conserved human and
mouse genes are discussed.
respectively. In all constructs mentioned above, HcTnC
MATERIALS AND METHODS promoter sequences extend 24 bp beyond the transcription
start site into the 5' untranslated region of the gene. The 3'
Plasmid construction. We constructed a 5' HcTnC pro- deletion constructs all start upstream at bp -67 of the
moter deletion series in the promoterless vector pCAT-Basic promoter and extend 3' to bp -52, -48, -39, -29, -13, -8,
(Promega). The resulting plasmids (Fig. 1) had various -2, +1, +10, and +23, respectively.
segments of the HcTnC promoter linked to the bacterial Full-length or truncated versions of the HcTnC first intron
CAT reporter gene. We first subcloned the 3.0-kb HcTnC were synthesized by the polymerase chain reaction (PCR)
HindIII-XhoI promoter fragment from pHsTnC4000CAT (63, 64, 100) (see below). These DNA segments were in-
(87) into the HindIII-XhoI site of pHcTnC1318CAT (87). The serted into a BamHI site downstream of the CAT gene, in
resulting plasmid (pHcTnC4500CAT) contains 4.5 kb of both sense and antisense orientations, in plasmids pHcTnC
HcTnC promoter sequences. Promoter-CAT chimeras with 4500CAT, pHcTnC1318CAT, and pHcTnC67CAT. In addi-
shorter 5' flanking sequences included pHsTnC714CAT, tion, the segments were inserted upstream of the CAT gene
pHsTnC538CAT, pHsTnC400CAT, pHsTnC225CAT, and in plasmid pCAT-Promoter (Promega), which contains the
pHsTnC67CAT, as previously described (87). Additionally, simian virus 40 (SV40) basal promoter. All constructs were
pHcTnC142CAT was constructed by exonuclease BAL 31 validated by diagnostic restriction enzyme analysis and
digestion (37) of pHsTnC400CAT. dideoxy DNA sequencing (82).
Plasmid pHcTnC67CAT was used to construct nested sets Synthesis of oligonucleotides and PCR products. Oligonu-
of 5' and 3' basal promoter deletions. For 5' deletions, we cleotides were synthesized on an Applied Biosystems model
linearized the plasmid DNA by cleavage at a unique PstI site 380A DNA synthesizer. The first intron of the gene, previ-
immediately 5' of the promoter sequences and then treated it ously reported as 1,466 bp (87), is 1,471 bp from +52 to
with exonuclease BAL 31. PstI linkers were then added to + 1522. This differs from our previously reported sequence in
the fragments generated. For the 3' deletion series, we that a pentameric sequence, CCCCA, has now been found to
linearized pHcTnC67CAT at the unique XbaI site at bp +24, be located following bp 1055. All base locations in this report
in the 5' untranslated region. After BAL 31 digestion, we are designated on the basis of this corrected observation. We
added XbaI linkers to the fragments. For both deletion sets, used a common antisense 3' primer that overlaps the splice
PstI-XbaI-digested fragments were subsequently cloned into acceptor site and a set of three sense-strand 5' primers to
the PstI-XbaI large fragment of pCAT-Basic. DNA sequenc- synthesize a nested set of first-intron elements with a com-
ing of the resulting constructs located the new 5' ends at bp mon 3' end. Each of the primers carried a BamHI restriction
-61, -55, -42, -40, -39, -37, -33, -32, -17, and -8, endonuclease site substitution in its midst (underlined). The6754 CHRISTENSEN ET AL. MOL. CELL. BIOL.
downstream antisense orientation primers were TC 1-4 (3'-GG cell isolation by calcium phosphate-mediated gene transfer,
AAAGGAACCTAGGTCTCGTCGACTG-5' [1510 to 1536]) using 15 ,ug of DNA, including 5 ,ug of reporter DNA, per
and TCO-3 (3'-CCGAAGACTCCGCCCTAGGCGTCGGT dish. Cells were harvested 48 h later.
CCCCCGGTCTATTG-5' [1012 to 1051]). The upstream All transfection experiments were carried out in duplicate
sense orientation primers were TC 2-4 (5'-CTACAAGGC or triplicate and were repeated at least twice, using plasmid
TGCGGATCCGGACAGGGCTGGG-3' [39 to 64]), TCO 1 DNA that had been purified by two CsCl density gradient
(5' -GGAGGGTGTGAGAGGAGGATCCTGTAGAGCCTG centrifugations (81). Thin-layer chromatography was used
AG-3' [524 to 558]), and TCO 2 (5'-GGCTTCTGAGGCGGCA for CAT assays (35), and plates were analyzed on an AMBIS
GGATCCGCCAGGGGGCCAGATAACG-3' [1012 to 1052]). radioanalytic imaging system. In most instances, acetylation
Each 100-pl reaction mixture contained the antisense of substrate was less than 50% to ensure that the assay
primer and one of the sense primers at a concentration of 0.6 results reflect values in the linear range of enzyme activity.
p,M; 1 ,ug of HcTnC template DNA from plasmid pB8A (87); The values reported are relative to the CAT activity of cells
10 ,ul of lOx PCR buffer (100 mM Tris-HCl, 500 mM KCI, 15 transfected in parallel with plasmid pCAT-Basic.
mM MgC12, 0.1 % [wt/vol] gelatin); 2 pl each dATP, dCTP, The long terminal repeat (LTR)-MyoDl eukaryotic ex-
dGTP, and dTTP (each at a concentration of 10 mM); and 0.5 pression vector (26), the Moloney virus LTR-CAT (pEMSV-
pl of Taq polymerase (AmpliTAQ; Perkin-Elmer Cetus). CAT) expression vector (41), and the LTR-Id expression
vector (pEMSVscribea2-Id) (4) were kind gifts from Andrew
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
PCR synthesis of 25 cycles on a DNA Thermal Cycler
(Perkin-Elmer Cetus) was carried out with the following Lassar, Stephen Tapscott, and Harold Weintraub (Fred
temperature steps: 94°C for 1 min, 45°C for 40 s, and 72°C for Hutchinson Cancer Center, Seattle, Wash.). The muscle
2 min. Following phenol-chloroform purification, the DNA creatine kinase (MCK)-CAT construct containing the 206-
products were prepared for subcloning by cleavage with nucleotide mouse MCK upstream enhancer fragment (-1256
to -1050) inserted 5' of the MCK promoter in -80MCKCAT
restriction endonuclease BamHI. (44) and was kindly provided by Stephen Hauschka (Univer-
For gel mobility shift and methylation interference foot- sity of Washington).
printing assays, we synthesized the following double- Nuclear protein extracts. Crude nuclear extracts from C2
stranded wild-type and mutated oligonucleotides spanning cells were prepared as described by Dignam et al. (28).
the HcTnC basal promoter sequences (-87 to -44; the Buffers were supplemented with additional protease inhibi-
arrowheads underlie the tandem TGGGC repeats discussed tors, leupeptin (2 pug/ml) and aprotinin (2 ,ug/ml), as previ-
in the text): ously described (85). Cardiomyocyte nuclear extracts were
87/44 wild type prepared by methods similar to those described previously
5'-ACACOGCAGGGGTGGGOCTGGGCTGGGCTGGGOTGGGCCAGGAATG-3' (83).
GEMS assays and methylation interference footprinting.
87/44 ±1 Oligonucleotides and DNA fragments were end labeled with
5'-ACACGCAGGGGTactCTactCTactCTGGGCTGGGCCAGGAATG-3' [y-_2P]ATP, using T4 polynucleotide kinase. Synthetic oli-
gonucleotide top strands were annealed with a fourfold
Additional oligonucleotides used were Spl (5'-ATTCGA molar excess of the corresponding bottom-strand unlabeled
TCGGGGCGGGGCGAGC-3' [13]) and AP2 (5'-GATCGAA oligonucleotide. The gel electrophoresis mobility shift
CTGACCGCCCGCGGCCCGT-3' [102]). In addition, we (GEMS) reaction mixture included 1 ng of annealed oligo-
made oligonucleotides for the HcTnC consensus MEF-2 nucleotide, 8 ,ug of CV-1 or C2 myotube nuclear extract, 3
binding sequence (from 1109 to 1131) and consensus E-box p,g of poly(dI-dC) as a nonspecific competitor, and various
binding sequence (from 1196 to 1214). amounts of specific synthetic double-stranded oligonucleo-
Cell culture, DNA transfection, and CAT assays. C2 and L8 tides or unlabeled DNA fragments as competitor DNAs
myogenic cells (107, 108) were grown in growth medium to adjusted to a final volume of 30 RI with buffer C (28). The
70% (C2) and 85% (L8) confluency and transfected with conditions for reaction mixtures containing labeled DNA
DNA by the calcium phosphate method essentially as de- fragments are given in the legend to Fig. 6. Prior to poly-
scribed previously (58, 87). In each transfection, the DNA acrylamide gel electrophoresis, the reaction mixture was
precipitate contained an equimolar amount of reporter plas- incubated at room temperature for 20 min. Following elec-
mid. At 7 (L8 cells) or 24 (C2 cells) h after transfection, the trophoresis, the gels were stained in 10% acetic acid-10%
cells were switched to differentiation medium and incubated methanol, dried, and autoradiographed.
for another 48 h before harvesting as myotubes. CV-1 (45) For methylation interference footprinting, the amounts of
and C3H 1OT1/2 cells (77) were grown in Dulbecco modified reagents used for a GEMS assay as described above were
Eagle medium with 10% fetal calf serum and 2 mM glutamine scaled up 10 times. Prior to incubation with the nuclear
and transfected at 60 to 70% confluency. Medium was extract, the end-labeled synthetic oligonucleotide was par-
replaced 14 (CV-1 cells) or 22 (C3H 1OT1/2 cells) h later and tially methylated (91). Following electrophoresis and auto-
harvested after another 48 h. radiography, unbound probe and probe complexed with
Neonatal rat cardiomyocytes were isolated as described nuclear proteins were electroeluted. The samples were
by Simpson and Savion (90). Heart tissue was minced, after cleaved with 10% piperidine, purified, and lyophilized twice
which the cells were dispersed by gentle trypsinization and (85). Equal amounts of radioactivity from free and com-
mechanical dissociation over a period of 4 to 5 h. Cardiac plexed probe were electrophoresed in 15% polyacrylamide
fibroblasts were selectively removed from the preparation by gels containing 7 M urea and autoradiographed.
preplating for 30 to 60 min. Cardiomyocytes were then
plated at a density of 4 x 106 cells per 60-mm-diameter RESULTS
culture dish and maintained in 5% CO2 in Eagle's minimal
essential medium supplemented with 5% fetal calf serum, 2 Expression in myogenic cells. (i) HcTnC expression is mod-
mM glutamine, and 100 U of streptomycin and penicillin per ulated by upstream regulatory elements. We first evaluated
ml. Cardiomyocyte transfections were performed 24 h after the potential contribution to gene expression of sequencesVOL. 13, 1993 CARDIAC TROPONIN C 6755
TABLE 1. Expression of HcTnC promoter and intron enhancer
pllTnCs4500CA r 39 ± 10
S in nonmuscle CV-1 ceilsa
pHTnCs4500CAT/II -1500-S 173 + 32 S DNA construct Fold CAT
activity ±+ SD'
pHTn('s4500CAT/l1-1500- AS 142 - 54 S£ S. pHcTnC4500CAT ....................................... 2 1
pHcTnC4500CAT/Il(S) ....................................... 3 ± 1.7
+
pHTnCsl3l8CAT 18 7 pHcTnC4500CAT/I1(AS) ...................................... 3 ± 2.1
SS
-
pHcTnC67CAT ....................................... 4 ± 0.8
pHTnCsl3l8CAlIT/11-1500-S 100 24 pHcTnC67CAT/I1(S) ....................................... 2±0
pHTnCs1318CA1/11-1500-AS 64 - 9 S S pHcTnC67CAT/I1(AS) .......................................
pSV4OCAT .......................................
2 ± 1
1.5 ± 0.7
SS
pSV40CAT/Il(S) ....................... ................ 1.5 ± 0.6
pHTnCs67(C'AT1
pHfTn(Cs67CAT/l I- I 500-S
9
57
+ I
0
S pSV4OCAT/Il(AS) .......................................
pOCAT .......................................
2.5 ± 0.6
1
S
-
a CAT assays of cellular extracts of CV-1 cells were performed after
pITnCs67CAT/I1-1500-AS 114 ± 66 transient transfection with pHcTnC4500CAT, pHcTnC67CAT, and
pSV40CAT. Each of the plasmids was also tested in the presence of the
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
full-length HcTnC first intron in the sense (S) and antisense (AS) orientations.
pOCAT I b Relative to the activity obtained with the promoterless pOCAT vector.
Experiments were carried out as described in the legend to Fig. 2.
FIG. 2. Expression of the HcTnC promoter-CAT constructs in
myogenic cells. CAT assays of cellular extracts of C2 cells were
performed after transient transfection with pHcTnC4500CAT, such an enhancer also exists in the first intron of the HcTnC
pHcTnC1318CAT, pHcTnC67CAT, and pOCAT. Each of the TnC gene, we synthesized this segment of the gene by PCR and
promoter-bearing plasmids was also tested in the presence of the cloned it in both sense and antisense orientations behind an
full-length HcTnC first intron in the sense (S) and antisense (AS)
orientations. CAT activities are expressed as fold activity relative to enhancerless SV40/CAT reporter gene. As seen in Fig. 3, the
the activity obtained with the promoterless pOCAT vector. Equal HcTnC intron, in either orientation, positively augments
copy numbers of each construct were transfected, and total DNA transcription from this heterologous promoter five- to sev-
concentration per dish was kept constant by addition of carrier enfold. This enhancer activity is muscle specific, since these
DNA. Each value represents the mean and standard error of at least constructs do not express in nonmuscle 1OT1/2 cells (see Fig.
two sets of transfections done in triplicate. The autoradiograms are SB) or CV-1 cells (Table 1). These data demonstrate the
representative lanes from the same experiment. presence of at least one classical tissue-specific and orienta-
tion-independent enhancer in the first intron.
To determine whether the enhancer has an equally strong
upstream of the basal promoter (-67 to +24). As we effect on its natural promoter, we cloned the first intron, in
previously reported (87), 5' flanking sequences increased both sense and antisense orientations, downstream of the
expression of transfected plasmid DNA by myogenic C2 CAT gene in HcTnC constructs bearing 4,500, 1,318, or 67
cells. However, in that earlier study, CAT assays were not bp of promoter sequences. As seen in Fig. 2, the presence of
always performed in the linear range of enzyme activity and the intron in either orientation dramatically increases the
no significant transcriptional differences were detected expression of each of these constructs three- to sixfold.
among plasmids carrying 67 bp of 5' flanking sequence and These effects appear to be multiplicative rather than addi-
those carrying additional sequences up to -1318. We have tive. These results suggest that in the context of C2 cells,
readdressed this issue by carrying out a more extensive cell-type-specific expression of the HcTnC gene is regulated
series of assays in which enzyme activities were determined by interactions of several 5' promoter sequences and one (or
in the linear range of CAT activity with the level of acety- more) enhancers located in the first intron.
lation of substrate usually less than 50%. As seen in Fig. 2, To better define the location of the enhancer in the
the basal promoter at -67 augmented transcription approx- 1,471-bp HcTnC intron, we compared the activities of intact
imately 9- to 10-fold over the promoterless pOCAT con- and truncated segments of the intron. We used PCRs to
struct. With 5' upstream DNA segments reattached to this isolate fragnents representing various segments of the first
promoter, transcription was additionally increased to ap-
proximately 20-fold (pHcTnC1318CAT) and 40-fold (pHcTnC
4500CAT) over the promoterless control plasmid, pOCAT. 10- 0
Both the basal promoter and the longer constructs were pSN'40CAT
muscle cell specific, since none expressed significantly
above pOCAT background in nonmuscle cells (Table 1).
Thus, HcTnC gene expression is modulated by at least two
pSV4OCATrf1-o1500-S 73 - 19
S
muscle-specific upstream elements, one located between the
pSV4OCAT/l1-1500-AS 51_ 8 0
basal promoter and -1318 and the second located between pOCA'T 1 *
-1318 and -4500. Each element augments transcription
twofold. As described in detail below, when we tested
intermediate segment lengths for MyoD-responsive pro- FIG. 3. Intron 1 of the HcTnC gene contains muscle-specific
moter activity (see Fig. 5C), much of the proximal activity enhancer activity. CAT assays of cellular extracts of C2 cells were
could be attributed to sequences between -67 and -225. performed after transient transfection with pSV40CAT constructs
(;i) The first intron of the HcTnC gene contains a strong, bearing the first intron of the HcTnC gene in either the sense (S) or
antisense (AS) orientation. CAT activities are expressed as fold
cell-type-specific enhancer. Several muscle-specific genes, activity relative to the activity obtained with the promoterless
including the MCK (46) and TnI (48) genes, contain intra- pOCAT vector. Experiments were carried out as described in the
genic enhancers in the first intron. To investigate whether legend to Fig. 2.6756 CHRISTENSEN ET AL. MOL. CELL. BIOL.
A pHTI'n(s4500(C'ATI 39 ± 10 S A
pHTnCs4500CAT - MvoD 0.2% 6
pHX n((s43-q(AT/ 1 1500-S 173 3250
5
**
pHTnCs4500CAT + MyoD 92%
_
S.
pHTin('s4500(CATI I-1500-AS
pllTXnCs4500(.'CAlT 11 - 1000-S
142 ±
205 +
545_
355
5,
S*
pHTnCs1318CAT -NyoD 16% S
0 .- pHTnCsl3I8CAT' + MyOD 27%
p 1lTrn(C4500(:AT/I 1-1000-AS 157 - 425
35
1 :1
**4
pHTnCs225CAT' -NMoD 0.6%
pHTn(. s4500CAT/ I 500-S
pHl'n(s4500C(.A-lT/Il -500- AS
18 ±
135 19 .5
SO
',*i
pHTnCs22SCAT + MvoD 25%
pHTnCsI42CAT - MvoD 0.6%
pHTnCsl42CAT + MvoD 17%
S
.0 pHTnCs67( AT - MyoI) 0.1%
B
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
pHTnCs4500CAT/1-1500-S 112± 21
+ MyoD 5%
pHTnCs67CAT
p)HTDn(:S45OOCAT/11-10001L-S
p11TnC-'s4500C)ATfl1-500-S
88 39
117 ± 20
** S B
pO( A 1 I
S4f . pHTnCs67CAT/11-1500-AS - MyoD 0.2%
S
pHTnCs67CAT/I1-1500-AS + MyoD 82%
FIG. 4. Locations of at least two skeletal muscle enhancers in
intron 1. CAT assays of cellular extracts of C2 cells were performed pSV40CAT/11-1500-AS - MyoD 0.2% 5
after transient transfection with pHcTnC4500CAT carrying seg-
ments of the first intron in the sense (S) or antisense (AS) orienta- pSV40CAT/11-1.500-AS + MyoD 92% 9 I 0
tion. CAT activities are expressed as fold activity relative to the
activity obtained with the promoterless pOCAT vector. The intron pOCAT - MyoD 0.1%
segments tested are depicted in Fig. 1. (A) Sequences in the distal
one-third of the intron contain enhancer activity; (B) sequences in pOCATI + MyoD 0.1%
the proximal two-thirds of the intron contain enhancer activity.
C 100
Hn+MyoD
intron schematically depicted in Fig. 1. These fragments so .
were inserted into pHcTnC4500CAT, downstream of the * -MyoD
CAT gene. We compared the relative transcriptional activi- .-R 60.
ties of these constructs in C2 cells with the activities of those
IL
carrying either no intron sequences or the full-length intron. 4c
0-0 40.
As seen in Fig. 4, sequences in the proximal two-thirds 4c
C.)
(fragment 1000L) and in the distal one-third (fragment 500) of 20
the intron each had strong, independent enhancer activity.
We conclude that at least two segments of the first intron of
the HcTnC gene contain strong muscle-specific enhancer
H.C. , l.
.[j.n.n~~~~~~1
-4500 1318 .714 -538 -400 -225 -142 -67 467/ 11 SV40f 11
activity.
(iii) The upstream regulatory sequences and the enhancer HTnCs Promoter Element
are responsive to MyoD. MyoD is one member of the family FIG. 5. The HcTnC upstream sequences and intron 1 enhancer
of myogenic determination genes (8, 9, 26, 29, 57, 78, 103) are MyoD responsive. Various HcTnC CAT constructs were tran-
that is capable of initiating the myogenic program (for siently transfected into lO 1/2 cells with or without cotransfection
reviews, see references 70, 79, 92, and 97) and transactivat- of a MyoD expression vector. CAT activity is expressed as percent
conversion to acetylated forms of chloramphenicol. Experiments
ing many muscle-specific genes (8, 11, 12, 17, 18, 31, 49, 52, were otherwise carried out as described in the legend to Fig. 2.
75, 80, 85, 96, 99) in nonmyogenic cells such as CV-1 (85) MyoD had a nonspecific stimulatory effect on expression of the
and C3H 1OT1/2 (98). The transactivating potential of these ,B-actin promoter-CAT vector and pEMSV-CAT vector (26), but
myogenic determination factors is manifest by their direct these were never higher than 1.2% conversion (12-fold). (A) MyoD
action as DNA-binding transcription factors or their ability responsiveness of plasmids pHcTnC4500CAT, pHcTnC1318CAT,
to induce other myogenic transcription factors. pHcTnC225CAT, pHcTnC142CAT, and pHcTnC67CAT; (B) MyoD
To test whether the positively acting transcription ele- responsiveness of the HcTnC first intron in plasmids pHcTnC
ments discovered in the HcTnC gene could be transactivated 67CAT and SV40CAT; (C) summary of effects of MyoD on expres-
by MyoD, we cotransfected 1OT1/2 cells with various sion regulated by HcTnC upstream and enhancer sequences.
HcTnC chimeric CAT constructs plus an expression plasmid
in which MyoD was constitutively driven by a viral LTR
(26). Since MyoD expression in these cells can initiate a other transcription factors (for example, MEF-2 [23, 36, 50,
myogenic differentiation program, these experiments cannot 55, 62, 97, 111]). As seen in Fig. 5A, MyoD expressed in
distinguish between direct interactions between the HcTnC trans stimulates expression of plasmids bearing various
DNA and MyoD or indirect effects, such as the induction of lengths of upstream sequences and in most cases by severalVOL. 13, 1993 CARDIAC TROPONIN C 6757
TABLE 2. Effect of Id on transactivated expression of plasmids TABLE 3. Effect of Id on expression of HcTnC plasmids in
in 1OT1/2 cellsa C2 cellsa
CAT activityb CAT activity'
DNA construct DNA construct
- Id + Id - Id + Id
pHcTnC67CAT 11.4 1.3 pHcTnC67CAT 4 1
pHcTnC67CAT/I1-1500(S) 21.6c 0.4 pHcTnC67CAT/I1-1500(S) 22 3.2
pHcTnC4500CAT 16.1 0.35 pHcTnC67CAT/1-500(S) 9.9 2.5
SV40/I1-1500CAT(S) 41.9 0.6 SV40CAT/I1-1500(S) 19 4.8
MCK-CAT 44.7 0.4 pOCAT 0.25 0.45
pMSVCAT 23.4 33.2
a 1OT1/2 cells (100-mm-diameter dishes) were cotransfected with various
CAT plasmids, the MyoD expression vector pEMSV, and 30 ,g of either the a C2 myoblasts were cotransfected with various CAT plasmids plus 20 ,ug of
Id expression vector pMSVId (+ Id) or plasmid carrier DNA (- Id). either the Id expression vector pMSVId (+ Id) or pMSV backbone (- Id).
b Reported as percent acetylated chloramphenicol. The carrier DNA was After 24 h, the cells were switched to differentiation medium and harvested 72
pUC18 excepted as noted. h later as described in Materials and Methods.
c The carrier DNA was pMSV backbone. b Reported as percent acetylated chloramphenicol.
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
hundred fold above the level of expression of the promoter- transcriptional activation by MyoD or an indirect mecha-
less control plasmid, pOCAT. The effects of MyoD on the nism involving other activators.
transactivation of plasmids carrying 714, 538, and 400 bp of Expression in myocardial cells. The cTnC gene is ex-
5' sequences were similar (not shown). Equally important, pressed in myocardium as well as in slow-twitch skeletal
MyoD has a similar (>500-fold) effect on the transcription of muscle. Accordingly, we next attempted to determine
plasmids bearing the first intron enhancer linked to either whether the same sequence elements that operate in myo-
HcTnC or SV40 basal promoter (Fig. 5B). Each of the intron genic cells are responsible for expression in cardiomyocytes.
subfragments described is also strongly transactivated by We transfected various HcTnC-CAT constructs into primary
MyoD (data not shown). The HcTnC basal promoter is rat neonatal cardiomyocytes as described in Materials and
transactivated slightly by MyoD (four- to fivefold), but no Methods. As seen in Table 4, the cTnC gene expresses
more so than can be accounted for by a nonspecific effect on strongly in these myocardial cells. The construct
3-actin (39) and Moloney sarcoma virus (41) promoters used pHcTnC1318/I1-1500 expresses more than 13-fold higher
as controls (not shown). Taken together, these data (sum- than a basal promoter does and is more active than the
marized in Fig. SC) suggest that the upstream regulatory well-characterized cardiac and skeletal a-actin reporter plas-
regions and the intragenic enhancers are independently mids. Surprisingly, HcTnC sequences in the 5' flanking
responsive, either directly or indirectly, to MyoD and, region upstream of -67 do not contribute to myocardiocyte
likely, to the other myogenic determination factors. It is the expression. Transcriptional activity above basal promoter
cooperative interactions of promoter and enhancer that are activity is seen only with the first intron. To delineate the
responsible for muscle-specific transcription of the HcTnC location of the myocardiocyte-enhancing activity in the first
gene. In addition, these data suggest that sequences be- intron, we compared constructs with the full-length intron or
tween -67 and -142 are responsible for much of the intron subsegments. The 5'-most 1,000 bp of the intron are as
MyoD responsiveness of the more proximal upstream pro- active as the full-length intron, whereas the 3'-most 500 bp of
moter. the intron do not contribute to expression in myocardio-
To verify further that the transactivation of the HcTnC cytes. Thus, the myocardiocyte- and skeletal muscle-specific
promoter constructs was caused by the presence of MyoD components of the enhancer in the first intron do not appear
protein, the CAT activities engendered by selected con- to be at the same location. Thus, there are two significant
structs were assayed in the presence and absence of a
plasmid vector expressing Id. Id forms inactive heterodimers
with bHLH proteins and inhibits the activity of MyoD (4).
As seen in Table 2, the presence of an Id expression vector TABLE 4. Expression of HcTnC promoter and enhancer
elements in rat cardiomyocytesa
inhibits the transactivation by MyoD of HcTnC reporter
genes in 1OT1/2 cells. In control experiments, a construct DNA
DNAconstruct Fold induction
SD
bearing the enhancer of the MCK gene, which is known to be
directly MyoD responsive, was also suppressed by the Id pHcTnC404CAT .2.3 + 0.8
vector. pHcTnC4 .8.7 2.9
500CAT/Il-1500
The inhibition by Id appears to be effective equally on pHcTnC4500CAT/I-1000L .8.6 + 2.0
both the promoter and the first intron of the HcTnC gene, pHcTnC450CAT/T1-500 .2.9 ± 0.6
since the expression of an enhancerless SV40 construct pHcTnC1318CAT .3.5 0.9
bearing intron 1 is also suppressed by Id. Furthermore, pHcTnC1318CAT/11-1500 .13.4 + 3.5
cotransfection with the Id expression vector pMSVId sup- pHcTnC714CAT .1.9 0.6
pHcTnC400CAT .1.5 1.3
presses the expression of the HcTnC plasmids in myogenic pHcTnC22CAT .3.1 ± 1.8
C2 cells (Table 3). Again, both promoter and intron muscle- pHcTnC67CAT .......................................... 3.3 ± 2.5
specific elements are suppressed by Id. A nonmuscle pro- pHcTnC67CAT/Il-1500 ........................................ 8.5 ± 1.8
moter, the Moloney sarcoma virus LTR (pMSVCAT), was Human skeletal oa-actin CAT ................................. 11.3 +6.5
unaffected, as expected. We conclude that the transcrip- Human cardiac a-actin CAT .................................. 6.1 ± 3.1
tional activities of these promoter and enhancer elements are pOCAT .......................................... 1
responsive to the myogenic environment induced by MyoD, a Primary neonatal rat cardiomyocytes were isolated and transfected with
but these experiments do not distinguish between direct various plasmids as described in Materials and Methods.6758 CHRISTENSEN ET AL. MOL. CELL. BIOL.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 fragment. In contrast, only complex B forms with nuclear
- A,. .* w _
aft _.& protein extracts derived from cardiomyocytes (lane 12), and
this band appears to be specific, since it is competed for by
excess unlabeled DNA probe (lane 13) but not by nonspecific
DNA (lane 14). Thus, complex A appears to be formed only
in C2 nuclear extracts.
A muscle-specific basal promoter is located between -61
and -13. To study in more detail the cis-acting regulatory
B
sequences responsible for the basal promoter activity lo-
cated between -67 and +24 (87), chimeric plasmids bearing
a nested series of closely spaced 5' or 3' deletions of the
HcTnC promoter linked to the CAT reporter gene were
transiently transfected into myogenic cells (Fig. 7) and
nonmyogenic CV-1 cells. None of these constructs ex-
pressed in CV-1 cells (data not shown). The HcTnC -67-bp
promoter construct has muscle-specific activity that is ap-
proximately ninefold higher than the activity of the promot-
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
erless plasmid (also see Fig. 2). Deletion beyond -61 pre-
FIG. 6. GEMS assay of a 230-bp DNA enhancer with C2 and cludes significant transcription activity. The results of the 3'
cardiomyocyte nuclear extracts. The GEMS assay was performed deletion analysis show that deleting sequences starting from
as described in Materials and Methods. All reaction mixtures
contained 1 ng of a [y-32P]ATP-labeled HcTnC 230-bp intron en-
+24 had no effect upon transcription activity until the
hancer fragment (from 1029 to 1258) mixed with 1.1 p.g of C2 cell deletions extended upstream from -13 into the TATA box.
nuclear extract (lanes 1 to 7 and 9 to 11) or 2.5 ,ug of cardiomyocyte Taken together, these data suggest that a basal promoter
nuclear extract (lanes 12 to 14). C2 extract mixtures also contained which retains muscle specificity lies between -61 and -13
3 1Lg of poly(dI-dC) DNA. Reaction mixtures were adjusted to a final and includes a consensus TATA box.
volume of 20 pl. The reaction mixtures contained 50 (lanes 2, 10, An Spl-like transcription factor interacts with the basal
and 13) or 150 (lane 3) ng of the unlabeled 230-bp fragment or 50 ng promoter. We next examined the basal promoter for evi-
of pUC18 DNA (lanes 11 and 14). Competition was carried out with dence of nuclear protein-DNA interactions. Accordingly, we
30 or 150 ng of an HcTnC MEF-2 (lanes 4 and 5) or HcTnC E-box compared the results of GEMS assays using nuclear protein
(lane 6 and 7) oligonucleotide. Lanes 1 to 7 and 8 to 14 are extracts from C2 or CV-1 cells. When we incubated nuclear
autoradiographs of two independent experiments. A and B designate extracts with a [y-32P]ATP-end-labeled synthetic oligonucle-
two major complexes discussed in the text. otide (from -87 to -44), we observed a characteristic band
shift in GEMS assays (arrow in Fig. 8A). This band was
specifically competed for with an identical but unlabeled
differences between the major elements responsible for oligonucleotide. The band has similar migration patterns
myocardiocyte and C2 cell expression. First, sequences with both muscle and nonmuscle extracts (not shown).
upstream of the basal promoter at -67 appear to play no role Because deletion of sequences between -61 and -55
in myocardiocyte expression. Second, the first intron con- destroyed the basal promoter activity, we suspected that the
tains at least two strong enhancer elements. One in the 5' site of interaction was located in a tandem (TGGGC)5
portion enhances both myocardiocyte and C2 cell expres- sequence located in this region. Methylation interference
sion, while a second in the 3' portion enhances C2 cell footprints confirmed this (see below). Because these se-
expression only. quences resemble GC-rich Spl binding sites, we used two
Nuclear protein interactions with a muscle-specific intron known Spl-binding oligonucleotides, from the SV40 pro-
enhancer segment. Comparison of the intron nucleotide moter and the G3 site from the human cardiac a-actin
sequence of the human and mouse genes (see Fig. 10 and promoter (40), as competitive inhibitors. The shifted band
Discussion) reveals a sizable segment of apparent sequence was competed for by itself and by the Spl and G3 oligonu-
conservation in the first intron coincident with the location cleotides but not by AP-2, a sequence known to bind other
of the 3' C2 cell enhancer activity, a segment that does not transcription factors (Fig. 8A). Thus, Spl or an Spl-like
enhance expression in myocardiocytes. Several consensus nuclear protein is the major nuclear protein capable of
sequences for known muscle-specific transcription factors interacting with the basal promoter, and this interaction may
(E boxes and MEF-2 binding sites) are present in the be responsible for basal promoter transcriptional activity.
conserved segments. We have determined that a 230-bp Nuclear extracts from nonmuscle CV-1 cells gave indistin-
segment of the first intron (from 1029 to 1258), which guishable binding and competition results with self and the
overlaps the conserved sequences, has the full enhancer G3 oligonucleotide (not shown).
activity of the 3'-most element, I1-500 (20a). We have Spl binds to three of five TGGGC DNA sequences in the
examined the ability of C2 cell and myocardiocyte nuclear HcTnC basal promoter. To determine more precisely the
extracts to interact with this segment of DNA. When as- location of the interaction between the HcTnC promoter and
sayed by electrophoretic mobility shift assay with C2 cell nuclear proteins, we end labeled and then partially methyl-
nuclear extract, two major complexes (A and B in Fig. 6, ated an oligonucleotide consisting of the HcTnC -87 to -44
lanes 1 and 9), form. These protein-DNA complexes are promoter sequences. After incubation with C2 nuclear ex-
specific, since they are competed for by an excess of the tract, we examined the effect of methylation to interfere with
unlabeled 230-bp DNA fragment (lanes 2, 3, and 10) but not strand scission by piperidine. The methylation interference
by excess nonspecific DNA (lane 11). The specific com- footprinting (Fig. 9) shows protection of the guanine residues
plexes are not competed for by synthetic double-stranded on the sense strand of the first two of the five TGGGC
oligonucleotides encoding the putative MEF-2 binding site repeats (from -76 to -67). A footprint of the antisense
(lanes 4 and 5) or E box (lanes 6 and 7) located in the 230-bp strand (not shown) shows partial protection only in theVOL. 13, 1993 CARDIAC TROPONIN C 6759
% CAT Activity ± s.d.
X 0 s s 1X
_62
.4
47
*61
.4
.5-
.3 -
-30 -20 -10 +10 +20
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
-70 60 650 40 ,
I I I I F- I.1 I
GGGGTGGGCTGGGCTGGGCTGGGCTGGGCCAGGAATGCAGCGGGGCAGGGCTATTTAAGTCAAGGGCCGGCTGGCAACCCCAGCAAGCTGTCCTGTGAGCCGCC
FIG. 7. HcTnC 5' and 3' promoter deletion analysis determines the boundaries of the basal promoter. Constructs bearing nested 5' or 3'
deletions from -67 or +24, respectively, were transiently transfected into L8 myogenic cells. Expression of the HcTnC deletion constructs
is compared with the activity of pHcTnC74CAT, which serves as a 100% basal expression reference point. Transfections were carried out
as described in Materials and Methods. The DNA sequence of the sense strand of the basal promoter is shown at the bottom and numbered
relative to the start of transcription at +1 (right-angled arrow). The arrows below represent the five tandem repeats making up an Spl site
as discussed in the text. Bases bound by nuclear proteins in methylation interference assays are represented by filled (strong interference) and
stippled (partial interference) circles (see the legend to Fig. 9). The TATA box is underlined. The various nested deletions are represented
by the horizontal lines, and the results of the CAT assays are plotted on the right (filled circles) with bars representing standard deviations.
fourth repeat (from -61 to -57) at the single guanine residue there is no evidence for the presence of MyoD family
at -57. If Spl interacts only with the first three of the five proteins in the heart, implying that different transcriptional
TGGGC repeats, then why is a promoter bearing only the mechanisms are at work (26, 42, 83, 86, 103). In fact,
last two of the repeats still transcriptionally active (pHcTnC- alternative transcriptional activators regulate cardiac a-actin
61CAT in Fig. 7)? We created an oligonucleotide with gene expression in the heart, acting through the same E-box
replacement, by the bases ACT, of each of the GGG element required for skeletal muscle cell transcription (83).
sequences in the first three repeats (oligonucleotide 87/44 ,ul; Other mechanisms use alternate regulatory sequences in
Materials and Methods). We used this DNA fragment in gel heart and skeletal muscle. For example, the chick cardiac/
shift analysis of nuclear extracts. The data presented in Fig. slow skeletal TnT gene is activated in heart by M-CAT (53,
8A and B demonstrate that the mutant oligonucleotide 54), a protein that may be the homolog of TEF-1 (24,
remains capable of binding Spl but at apparent affinity lower 104-106), a ubiquitously expressed mammalian nuclear tran-
than that of the wild-type sequence. We conclude that Spl scription factor. The M-CAT binding site is not used to
interacts preferentially with the TGGGC repeats between activate cardiac/slow TnT in chick skeletal muscle.
-75 and -65, but in their absence, the TGGGC repeats Tests for skeletal muscle upstream regulatory elements. To
between -61 and -49 bind Spl and can support transcrip- investigate and identify skeletal muscle-specific elements in
tion. the HcTnC gene, we tested various segments of the gene for
the ability to support expression in skeletal muscle cell lines
DISCUSSION and the ability to respond to the presence of the MyoD-
induced myogenic program in nonmuscle cells. To do this,
cTnC is a critical component of the troponin complex in we examined the ability of promoter elements to respond in
the contractile thin filaments of both slow-twitch skeletal a skeletal muscle-specific environment by cotransfection of
muscle and myocardial muscle. The mRNA transcripts for 1OT1/2 cells with cTnC reporter chimeras and a viral LTR-
cTnC in heart and skeletal muscle are identical. In fast- driven MyoD expression vector. Since neither MyoD nor
twitch skeletal muscle, the cTnC isoform is replaced by the other members of the bHLH family of myogenic determina-
TnCf isoform. cTnC and TnCf are encoded by two different tion factors are detected in myocardium (26, 42, 83, 86, 103),
genes in mammals (34). Among contractile protein isoforms, we reasoned that MyoD responsiveness would be a test for
it is not uncommon that slow-twitch muscle and heart often regulatory elements used in skeletal muscle. Since MyoD
make use of the same gene, while fast-twitch muscle utilizes can induce other specific transcription factors, some of
a different gene (although there are a number of exceptions which, such as MEF-2 (1, 10, 23, 36, 68), are present in
to this [reviewed in references 5, 15, and 95]). Despite the heart, this assay can only distinguish elements unequivocally
phenotypic similarities between skeletal muscle and myocar- used in skeletal muscle and not used exclusively in heart.
dial cells and the expression of many of the same sarcomere- These experiments have identified independent myogenic
specific genes, it is not clear whether the same mechanisms regulatory elements in widely scattered upstream regions, as
are used to regulate the expression of the same genes in the well as an enhancer in the first intron, of the HcTnC gene.
two cell types. Indeed, transcriptional regulators of the Two upstream regions, between -67 and -142 and between
MyoD family activate genes expressed in both heart and -1318 and -4500, are capable of contributing to the level of
skeletal muscle such as the cardiac a-actin gene. However, muscle-specific expression of reporter gene chimeras. None6760 CHRISTENSEN ET AL. MOL. CELL. BIOL.
A self 1 Sp-1 AP2 G3
competitor
DNA in ng
o 30 300 ,3
:i >
I - of
-30 30 IJF3o M-
I * ll
*~~~
(2I
C,
* t
(J7
(I
'I
t: I
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
B probe (I
self Sp-1 (I
competito 0 30 300 1: oo AP2
00 ITf7
300
G3 alone
..&r
. ',s
DNA in ng
FIG. 9. Methylation interference footprint of the HcTnC basal
promoter sense strand with C2 nuclear extract. An oligonucleotide
of the sense (top) strand of HcTnC promoter from bp -87 to -44
was partially methylated and incubated with nuclear extract of C2
myogenic cells. Equal amounts of bound and unbound probe were
loaded onto the gel with bound DNA between two lanes of unbound
DNA. The footprint shows interference with guanines of the first
two of five TGGGC repeat sequences indicated by the arrows.
Similar experiments with the antisense (bottom) strand demon-
FIG. 8. GEMS assay of HcTnC wild-type (A) and mutant 87/44 strated only partial interference with guanines in the fourth TGGGC
p1l (B) basal promoters, using C2 nuclear extracts. The GEMS assay repeat (not shown).
was performed as described in Materials and Methods. All lanes
contain 1 ng of [_y_32p]ATP-labeled HcTnC wild-type or mutant (p1l)
oligonucleotide (bp -87 to -44) and 3 pLg of poly(dI-dC) nonspecific except for a conserved purine rich region, these are less
competitor DNA in a final volume of 30 pAl. Each reaction contained striking.
8 ~Lg of C2 cell nuclear extract. G3 is an Spl-binding oligonucleo- A CACCC box in the human sequence (5'-CTGCCCAC
tide (5'-AATI1CACCAGAAAGGGGGAGGGGTGGGCJTGGCGA-3' CCCCTGCAT-3' [1053 to 1070]) is similar to sequences
[40]). previously shown to be important for the binding of the
activated glucocorticoid receptor to eukaryotic promoters
(88) and for the transcription of the 13-globin gene (43) and
the human porphobilinogen deaminase gene (30). Interest-
of these constructs expresses in CV-1 or 10T1/2 cells, but ingly, a similar-size element in the first intron of the quail fast
each of them contributes to expression when cotransfected TnI gene that proved to be a muscle-specific enhancer also
into 1OT1/2 cells with a MyoD expression vector. contains a CACCC box (48). Recently, Williams and collab-
Enhancer elements in intron 1 interacts with the upstream orators reported that the CACCC box is an enhancer ele-
sequences. The intron of the HcTnC gene contains at least ment in the myoglobin promoter and important for expres-
two muscle-specific enhancers, one located in the first 1,028 sion of the gene in cardiomyocytes (38) and skeletal muscle
bp of the intron and the other located in the last 495 bp (from cells (4).
bp 1029 to 1523). The intron elements augment transcription There is also a MEF-2 binding site conserved between the
from the HcTnC promoter as well as from a heterologous human and mouse intron I sequences (5'-CGTTAAAAAT
viral promoter when placed downstream of reporter genes AGCCC-3' [1113 to 1127 in the human sequence]). MEF-2
and does so exclusively in myogenic cells. As seen in the dot has been shown to have potent function in transcription of a
matrix comparison between mouse and human cTnC se- number of muscle-specific genes (23, 36, 110), and cloned
quences (Fig. 10), a 494-bp segment from 961 to 1454 is MEF-2 sequences can transactivate MEF-2 site-dependent
highly conserved in the human and mouse sequences and reporter genes in nonmuscle cells (56, 109). A conserved
contains several potential transcription factor binding sites CArG box (5'-CCATACAAGG-3' [977 to 986]) is a potential
present in the enhancers of both species: a CACCC-box, a target of serum response factor (6, 7, 94). The role of this
MEF-2 site, a CArG box, and several E boxes. Although CArG box, if any, remains unclear, since in our experi-
there are short segments of similarity between the mouse ments, the shortest intron element tested (1029 to 1523) does
and human sequences in the 5' two-thirds of the intron, not contain this CArG box but appears to function as well asVOL. 13, 1993 CARDIAC TROPONIN C 6761
Human ability to form specific complexes with extracts of C2 cell or
400 800 1200 cardiomyocyte nuclear extracts. One of two major com-
plexes formed with C2 cell extracts did not form with
cardiomyocyte extracts. This observation allows us to spec-
ulate that the C2 cell-specific complex might be involved
400-
with the tissue specificity of enhancer activity. Neither
Purine Rich
MEF-2 nor E-box oligonucleotides compete for the forma-
: tion of the complexes formed with C2 extracts. However, it
still remains possible that the complexes represent highly
stable ternary protein-DNA complexes involving either or
800-
CArG both MEF-2 or bHLH heterodimers. More detailed analysis
/ CACC of these complexes is required.
v E1 Some genes that are coexpressed in heart and skeletal
muscle, such as those encoding cTnT (21, 22) or myosin light
1200-
MEF2 chain 2 (51, 69, 110), do have distinct modes of regulation
/ E
(reviewed in reference 84). Thus, one might expect that
/ E3
either divergent or overlapping regulatory programs specify
Downloaded from http://mcb.asm.org/ on March 6, 2015 by guest
expression of such genes in the two muscle types. Other
FIG. 10. Conserved DNA sequences in the first-intron enhancers genes expressed in both heart and skeletal muscle, such as
of mouse and human cTnC. The sequences of mouse (72) and human the cardiac a-actin gene, appear so far to have indistinguish-
(87) cTnC first introns were compared by using the dot matrix able modes of transcriptional regulation in the two tissues.
analysis program Geneworks (Intelligenetics Inc.). The plot was The cTnC gene is equally expressed in slow-twitch muscle
printed at four residues per pixel. Sequences were compared by
using a range of 10 with at least 70% similarity. The numbers on the and heart throughout ontogeny, and there is no a priori
abscissa (human sequence) and ordinate (mouse sequence) start requirement for independent myocardial and skeletal muscle
with the first bases of the respective introns. These represent base regulatory pathways. Still, cTnC is briefly expressed in
52 of the transcribed human sequence (87) and base 68 of the embryonic fast-twitch skeletal muscle fibers, and this may
transcribed mouse sequence (72). Several conserved sites with contribute to the differences that we observe when compar-
potential regulatory implications are noted. ing a cell line with a primary cell in culture. However, our
preliminary evidence using direct myocardial and skeletal
muscle DNA injection tends to support the in vitro results
longer fragments that do contain it. Downstream of the (75a).
MEF-2 element lie three E boxes, the target site for bHLH Apparent redundancy in Spl basal promoter repeats. A
transcription factors (25, 49, 65), that are conserved between basal promoter for HcTnC is located between -61 and -13.
human and mouse intron sequences (5'-AGGGACA5 Lc Spl binds to the consensus site 5'-TGGGCGGQCT-3' (47).
GTC-3' [1197 to 1209], 5'-CCAGCTK GGTCAC-3' [1349 to The HcTnC basal promoter region contains no fewer than
1362], and 5'--CACCTGT-3' [1448 to 1454]). five adjacent TGGGC sequences between -76 and -51, and
Although the 466-bp segment of the first intron enhances gels shift assays demonstrate that Spl binds to this region.
transcription at levels nearly equal to that of the entire Methylation interference footprinting showed that only the
intron, sequences in the upstream portion of the intron can, first and second (and possibly the fifth) TGGGC sites bind
by themselves, respond to MyoD and augment transcription Spl. Functional analysis by promoter deletion studies sug-
to equivalent levels. This upstream intron region contains gests, however, that the first and second repeats are not
five E boxes. Taken together, these observations suggest required for basal expression and that at most, only the
that skeletal muscle expression of the HcTnC gene is coop- fourth and fifth Spl sites are required. One possible expla-
eratively regulated by the complex interactions of multiple nation for these observations is that because these closely
regulatory elements. The positively acting elements are spaced tandem sites can likely interact with only a limited
scattered over at least a distance of 2.8 kb (upstream of number of Spl molecules, tandem repeats 1 and 2 are
-1318 to + 1523). The multiplicative effects on transcription preferred binding sites. However, when they are deleted,
suggest that there may be direct interactions between dis- downstream sites can become effective. We did observe
persed elements and their trans-acting regulatory factors. binding by Spl when we tested the ability of Spl to bind to
Distinct myocardiocyte and myocyte regulatory elements. repeats 4 and 5 by creating an oligonucleotide with mutations
Surprisingly, there appear to be significant distinctions be- in repeats 1, 2, and 3. In this regard, it may be relevant that
tween the HcTnC sequence elements important for skeletal the mouse cTnC gene contains a tandem repeat of two, not
muscle cells (as represented by C2 cells and 1OT1/2 cells five, similar putative Spl sites at -73 to -58 (however, see
transactivated by MyoD) versus myocardial cell expression below). Thus, if these sites represent functional Spl tran-
(as represented by neonatal cardiomyocytes in culture). scription regulation loci in the mouse, then two repeats may
Unlike the situation in C2 cells, the sequences upstream of be sufficient.
the basal promoter at -67 do not add to expression in Organizational differences between mouse and human cTnC
cardiomyocytes. Furthermore, of the regions tested, the promoters. After most of the experiments for this report
major activation of gene expression in cardiomyocytes were completed, Parmacek et al. published a valuable and
comes from sequences in the 5'-most two-thirds of the first extensive analysis of regulatory elements in the murine
intron, whereas the muscle-cell active sequences located in cTnC gene (73) that illuminates a number of differences from
the highly conserved 3' region appearing to play little or no our findings with the human cTnC gene. The findings of
role in myocardial expression. The enhancing capacity of the these authors regarding the expression of the mouse cTnC
first intron in cardiomyocytes has been confirmed in exper- gene can be summarized as follows. (i) The proximal up-
iments involving direct plasmid DNA injection in rat ventri- stream region of the mouse gene (from -124 to -56) is
cles (75b). We assayed a segnent of this 3' region for its exclusively a cardiac specific enhancer, and neither it norYou can also read
