Combined Detection and Genotyping of Chikungunya Virus by a Specific Reverse Transcription-Polymerase Chain Reaction
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Journal of Medical Virology 67:370–374 (2002)
Combined Detection and Genotyping of
Chikungunya Virus by a Specific Reverse
Transcription-Polymerase Chain Reaction
F. Hasebe,1* M.C. Parquet,1 B.D. Pandey,1 E.G.M. Mathenge,1 K. Morita,1 V. Balasubramaniam,2
Z. Saat,2 A. Yusop,2 M. Sinniah,2 S. Natkunam,3 and A. Igarashi1
1
Department of Virology, Institute of Tropical Medicine, Nagasaki University, Nagasaki, Japan
2
Division of Virology, Institute for Medical Research, Ministry of Health, Kuala Lumpur, Malaysia
3
Hospital TAR, Klang Selangor, Malaysia
A reverse transcription-polymerase chain reac- [Harnett and Bucens, 1990; Schmitz et al., 1996;
tion (RT-PCR) was developed for the detection of Eisenhut et al., 1999]. In Asia, the disease occurs
Chikungunya virus infection. Based on the non- mainly in children [Halstead et al., 1969], and its areas
structural protein 1 (nsP1) and glycoprotein E1 of occurrence overlap with those endemic for dengue
(E1) genes of Chikungunya, two primer sets were fever and dengue hemorrhagic fever [Myers and Carey,
designed. Total RNA were extracted from the cell 1967; Mackenzie et al., 2001]. The symptoms of
culture fluid of Aedes albopictus C6/36 cells Chikungunya infection are characterized by fever,
inoculated with the S27 prototype virus, isolated headache, severe back and joint pain, rash, and
in Tanzania in 1953, and the Malaysian strains lymphadenitis. These clinical features are similar to
(MALh0198, MALh0298, and MALh0398), isolated those seen in dengue virus infection [Nimmannitya
in Malaysia in 1998. For both sets of RNA sam- et al., 1969: Carey, 1971]. Concurrent isolation of both
ples, the expected 354- and 294-base pair (bp) Chikungunya and dengue virus was carried out from a
cDNA fragments were amplified effectively from blood sample taken from a patient in the acute phase of
the nsP1 and E1 genes, respectively. Phyloge- a dengue-like illness was reported [Myers and Carey,
netic analysis was conducted for the Malaysian 1967]. Thus, the differential diagnosis of these two
strain and other virus strains isolated from dif- infections is essential for clinical management and
ferent regions in the world endemic for Chikun- epidemiological study in the tropics. Although a
gunya, using partial E1 gene sequence data. The number of polymerase chain reaction (PCR) diagnostic
Malaysian strains isolated during the epidemics systems have been established for dengue virus infec-
of 1998 fell into a cluster with other members of tion, no reverse transcription (RT)-PCR diagnostic
the Asian genotype. J. Med. Virol. 67:370– system for Chikungunya infection has been reported
374, 2002. ß 2002 Wiley-Liss, Inc. [Chungue et al., 1993; Morita et al., 1994; Seah et al.,
1995; Sudiro et al., 1997; Harris et al., 1999]. The aim of
KEY WORDS: Chikungunya virus; RT-PCR; this study was to develop a rapid, sensitive, and virus-
nsP1; E1; genotyping; Malaysia specific RT-PCR assay as a quick diagnostic method to
INTRODUCTION
Chikungunya virus is an alphavirus (family Togavir- Grant sponsor: Department of Virology, Institute of Tropical
Medicine, Nagasaki University; Grant sponsor: Ministry of
idae, genus Alphavirus) serologically classified as a Education, Science, Sports and Culture of Japan; Grant number:
member of the Semliki Forest antigenic complex 10041201.
[Karabatsos, 1975]. It is transmitted to human beings A. Igarashi’s present address is Kyushu University of Health
by mosquitoes of the Aedes genus [Turell et al., 1992; and Welfare, Yoshino machi 1714-1, Nobeoka city, Miyazaki,
Diallo et al., 1999]. Chikungunya is prevalent in sub- Japan 882-8508.
Saharan Africa, Southeast Asia, India, and the Western *Correspondence to: F. Hasebe, Department of Virology,
Institute of Tropical Medicine, Nagasaki University,1-12-4 Saka-
Pacific, and where numerous epidemics have been moto, Nagasaki 852-8523 Japan.
reported [Rao, 1971; Thuang et al., 1975; Adesina and E-mail: rainbow@net.nagasaki-u.ac.jp
Odelola, 1991; Thein et al., 1992; Thaikruea et al., 1997; Accepted 21 November 2001
Thong et al., 1999]. Apart from cases that occur in DOI 10.1002/jmv.10085
endemic areas, cases of travel-related Chikungunya Published online in Wiley InterScience
infection have been reported in nontropical areas (www.interscience.wiley.com)
ß 2002 WILEY-LISS, INC.RT-PCR for Chikungunya Virus Diagnosis and Genotyping 371
identify Chikungunya infection especially in dengue
epidemic areas where equivocal assay results preclude
effective clinical management. This technique was used
subsequently to test serum samples for studies con-
ducted during a Chikungunya outbreak that occurred
in Malaysia in 1998.
MATERIALS AND METHODS
Isolation of CHIK Virus
A suspected Chikungunya outbreak occurred in
Malaysia in 1998. Serum samples were collected from
patients clinically diagnosed as, suspected cases of
Chikungunya infection. In this study, 10 ml of each
serum sample was inoculated into C6/36 cells cultured
in minimal essential medium (MEM) containing 2%
fetal calf serum (FCS) and 0.2 mM of each minimum Fig. 1. Alignment of nucleotide sequences of the nsP1 and E1 gene of
essential amino acid; the cells were then incubated at alphavirus strains belonging to the Semliki Forest antigenic group.
A: CHIK/nsP1-S primer annealing site. B: CHIK/nsP1-C primer an-
288C for 1 week. The infected cells were examined by nealing site. C: CHIK/E1-S primer annealing site. D: CHIK/E1-C
indirect immunostaining, using patient serum that primer annealing site. Abbreviations and GenBank accession numbers
(in parenthesis) are as follows: CHIK, Chikungunya (U94597 for nsP1
contained anti-Chikungunya polyclonal antibodies and sequence and L37661 for structural protein gene sequence); ONN,
horseradish peroxidase (HRP)-labeled goat anti-human O’nyong-nyong (AF079456); IGBO, Igbo Ora (AF079457); SFV, Semliki
IgG (American Qualex). Isolation of the virus was then Forest (Y17207); UNA, Una (U94603); GET, Getah (U94598); SAG,
Sagiyama (U94601); BEB, Bebaru (U94595); MAY, Mayoro (U94602);
confirmed by a newly established RT-PCR assay. The RR, Ross River (M20162). –, current sequence nucleotide is identical to
resulting infected culture fluid was harvested from that of CHIK.
each sample and stored at 808C until use.
Virus Strains Extraction of RNA
The virus strains used in this study are listed in Genomic viral RNA was extracted from 100 ml of
Table I. The viruses were propagated in C6/36 cells virus infected culture fluid using the Trizol LS
cultured as above, in 2% FCS MEM and 0.2 mM of each reagent (GIBCO-BRL), according to the manufacturer’s
minimum essential amino acid with incubation at 288C. instructions, and resuspended in 20 ml of RNase-free
The virus bearing culture fluid was harvested 5 days water.
after infection.
Reverse Transcription-Polymerase
Primer Design Chain Reaction
As only limited sequence data were available for RT-PCR was carried out with Ready-To-GoTM RT-
Chikungunya, the available data were compared with PCR Beads (Amersham Pharmacia Biotechnology) in a
other Alphavirus strains belonging to the Semliki 0.5-ml tube containing 0.5 mM of each primer and 5 ml of
Forest antigenic complex. Two primer sets were RNA template. The MJ Research Mini Cycler (PTC-
selected within the nsP1 and E1 genomic regions of 150-16 HB MJ-2716-00) was used for RT-PCR. The RT
Chikungunya which had well-conserved nucleotide reaction (428C for 10 min) was followed by 35 cycles of
sequences among the same complex of viruses but PCR (948C for 30 sec, 548C for 30 sec, and 728C for
were specific to the 30 end of the Chikungunya viral 30 sec, for each cycle). The final elongation step was
genome (Fig. 1 and Table II). extended to 5 min, to ensure complete extension of the
amplified products. In this study, 10 ml of PCR pro-
duct was subjected to 2% agarose gel electrophoresis in
TABLE I. List of Chikungunya and Dengue Viruses Used in Tris-acetate EDTA buffer (0.04 M Tris-acetate, 1 mM
This Study EDTA), stained with ethidium bromide, and visualized
on an ultraviolet (UV) transilluminator at 302 nm.
Year of
Virus Strains isolation Location Determination of Assay Sensitivity
Chikungunya virus S27 1953 Tanzania The stock seed virus of S27 strain was titrated in C6/
MALh0198 1998 Malaysia
MALh0298 1998 Malaysia
36 cells. Total RNA was extracted from the virus stock
MALh0398 1998 Malaysia containing 5.0 107 plaque-forming units (PFU)/ml
Dengue virus type 1 Hawaii 1945 Hawaii and serially 10-fold diluted in RNase-free water. To
ThNh7/93 1993 Thailand determine the sensitivity of each primer set, 10 ml of
InJ-I6-82 1982 Indonesia each RNA solution containing from 5.0 104 to 5 PFU
CT93-74 1993 Thailand
were used for amplification.372 Hasebe et al.
TABLE II. Nucleotide Sequences of Chikungunya Virus-Specific Primers
Primer code Sequence (50 to 30 ) Tm (8C) Product (bp)
nsP1 primer set
CHIK/nsP1-S TAGAGCAGGAAATTGATCCC 61.1 354
CHIK/nsP1-C CTTTAATCGCCTGGTGGTAT 61.7
E1 primer set
CHIK/E1-S TACCCATTCATGTGGGGC 62.7 294
CHIK/E1-C GCCTTTGTACACCACGATT 59.4
Direct Sequencing Analysis Virus Isolation From Malaysian Patients
The specific DNA amplicons were purified using a Three RNA samples from the culture fluid of C6/36
centrifugation purification device, Microcon (Millipore). cell inoculated with Malaysian patients sera were
Sequencing reactions were undertaken with the Taq found to be Chikungunya positive by RT-PCR, using
Dye Deoxy Terminator Cycle Sequencing kit (Applied the nsP1 and E1 primer sets (Fig. 2). The results were
Biosystems, Foster City, CA) and purified using Centri- consistent with those obtained for immunostaining
Sep columns as recommended by the manufacturer assay carried out on cultured cells. These Malaysian
(Princeton Separations, Adelphia, NJ). The sequences strains were named MALh0198, MALh0298, and
were resolved with an ABI PRISM 310 Genetic Analyzer MALh0398 (Table I).
(Applied Biosystems) and further processed using the
DNASIS 3.6 Software, Mac version (Hitachi). Direct Sequence Analysis of the Amplicons
Direct sequence analysis of RT-PCR products was
Phylogenetic Analysis carried out; among the Malaysian strains, only one
The 257-bp partial E1 gene sequence obtained was nucleotide sequence was found to be different in the
used for phylogenetic analysis. A phylogenetic tree nsP1 genome, whereas the amino acid sequences proved
comparing the 19 Chikungunya strains isolated from identical. For the 314-bp-long sequences of the nsP1
different endemic regions of the world was generated. gene, the S27 prototype and the Malaysian strains were
Apart from the Malaysian strain, all the nucleotide found to be 96.8–97.1% for the nucleotide sequences,
sequences used in this study were obtained from the and showed 100% homology for amino acid sequences.
GenBank. The names of the strains, place of isolation, For the 257-bp-long E1 gene sequence, the sequence
year, and accession numbers are indicated in Figure 3. homology between S27 and Malaysian strains was
A sequence of O’nyong-nyong virus, strain SG650, was 96.5% for the nucleotide sequences and 97.6% for the
included as an outgroup. deduced amino acid sequences. The sequence results of
The PHYLIP package of software programs (version MALh0198 and MALh0398 were identical.
3.5) [Felenstein, 1995] was used to calculate the
nucleotide evolutionary distances and to prepare phylo-
grams. The phylogenetic tree was constructed using the
Neighbor Joining Method [Saitou, 1987] and viewed
using TREEVIEW [Page, 1996]. A 1,000-times bootstrap
resampling of the data set was carried out to ascertain
support for the major branches of the tree.
RESULTS
RT-PCR Detection and Its Sensitivities
The expected 354- and 294-bp-long cDNA fragments
were amplified for the nsP1 and E1 gene, respectively,
using RNA extracted from the S27 prototype strain’s
infected culture fluid (Fig. 2). RNA templates of dengue
virus types 1–4 were all negative for both primer sets.
Fig. 2. Application of reverse transcription-polymerase chain reac-
The nsP1 primer set was able to detect viral RNA at tion (RT-PCR) to the RNA samples extracted from C6/36 cell culture
dilutions containing as low as 5 PFU, while the E1 fluids inoculated with Malaysian patients’ sera. RT-PCR was carried
out with the nsP1 primer set (lane n) and E1 primer set (lane e);
primer set was able to detect viral RNA from dilutions amplified products were subjected to gel electrophoresis. Ethidium
containing 50 PFU of S27 strain. Chikungunya viral bromide-stained agarose gel showing the expected 354 and 294 bp of
RNA was also detected from patients serum samples cDNA fragments that were amplified from nsP1 and E1 gene, res-
pectively (samples 3, 5, and 6). RNA template of S27 strain was used as
by application of a direct RT-PCR procedure [Morita, a positive (Posi.) control in the reaction. The molecular weights of the
1994], using the nsP1 primer set. 100-bp DNA marker are shown.RT-PCR for Chikungunya Virus Diagnosis and Genotyping 373
Fig. 3. Phylogenetic analysis of 19 CHICK strains. The tree was constructed for a 257-bp-long E1 gene
sequence using UPGMA. Locations, year of isolation, GenBank accession numbers, and genotypes are
indicated.
Phylogenetic Analysis distinguish them from the other alphaviruses. The
epidemiology and clinical features of Chikungunya
The evolutionary relationships among the 19 Chi-
have a number of similarities to those of dengue
kungunya strains were analyzed. These Chikungunya
viruses. Both viruses are prevalent in the tropics and
isolates were divided three different genetic clusters
subtropics and there is the possibility of large simulta-
which fell into geographical groups. The nucleotide
neous outbreaks involving these two viruses [Myers
evolutionary distances between the Malaysian strain
and Carey, 1967; Halstead et al., 1969; Carey, 1971].
and the other strain clusters belonging to the Asian,
Unlike dengue hemorrhagic fever and dengue shock
Central/East African, and West African genotypes
syndrome, Chikungunya infections are rarely fatal and
ranged from 0.0197 to 0.0361, 0.0440 to 0.0564, and
patients do not usually require hospitalization. There-
0.1323 to 0.1508, respectively. The Malaysian isolate
fore it is very important to differentiate Chikungunya
presented in this report clustered within the Asian
infection from dengue virus infections especially in
genotype (Fig. 3).
areas where dengue is endemic. The Chikungunya
outbreak occurred in a densely populated urban area
DISCUSSION
near Kuala Lumpur in Malaysia from 1998 to 1999. It
Chikungunya is related antigenically to other mem- was the first outbreak to be recorded in this country
bers of the same antigenic complex (Semliki Forest, [Mackenzie et al., 2001]. RT-PCR assay for the detec-
O’nyong-nyong, Ross River, and Mayaro viruses). An tion of Chikungunya infection was developed and
indirect enzyme-linked immunosorbent assay (ELISA) subsequently used to analyze the samples for studies
for the detection of anti- Chikungunya IgM antibody conducted during this outbreak. The two newly design-
and a genus-specific RT-PCR assay for detection of ed primer sets were able to detect both the African (S27)
alphavirus species have been developed [Thein et al., and the Malaysian Chikungunya strains, but did not
1992; Pfeffer et al., 1997]. About 75% of Chikungunya detect any of the 4 dengue virus serotypes nor Sindbis
patients failed to seroconvert within 24–48 hr of onset virus (data not shown). RT-PCR assays using the nsP1
of symptoms, and the clinical value of the neutraliza- and E1 derived primer sets were sensitive enough to
tion test in obtaining a differential serodiagnosis of detect 5 PFU and 50 PFU, respectively, for the S27
Semliki Forest antigenic complex viruses is not entirely strain. Although the amplified gene region is longer,
clear [Karabatsos, 1975]. The genus-specific RT-PCR the amplification efficiency was slightly higher when
assay was able to detect 27 alphavirus species, in- using nsP1 primer set (Fig. 2). Direct sequencing
cluding Chikungunya; however, it was unable to analysis was carried out on both amplified products374 Hasebe et al.
from the S27 and the Malaysian strains. Among Karabatsos N. 1975. Antigenic relationships of group A arboviruses by
Chikungunya strains the nsP1 gene was better con- plaque reduction neutralization testing. Am J Trop Med Hyg
24:527–532.
served than the E1 gene. Powers et al. [2000] reported Mackenzie JS, Chua KB, Daniels PW, et al. 2001. Emerging viral
that by phylogenetic analysis of a 1,050-bp segment diseases of Southeast Asia and the Western Pacific. Emerg Infect
of the E1 gene, Chikungunya isolates can be grouped Dis 7(suppl 3):497–504.
into three distinct genotypes (Asian, Central/East Morita K, et al. 1994. Rapid detection of virus genome from imported
dengue fever and dengue hemorrhagic fever patients by direct
African, and West African genotypes) according to polymerase chain reaction. J Med Virol 44:54–58.
geographical origin. In this study, although only a Myers RM, Carey DE. 1967. Concurrent isolation from patient of two
257bp long sequence of the same gene was used for arbovirus, chikugunya and dengue type 2. Science 15:157:1307–
1308.
analysis of 19 Chikungunya isolates, these strains
Nimmannitya S, Halstead SB, Cohen SN, Margiotta MR. 1969.
clearly fell into three distinct genetic groups. The Dengue and Chikungunya virus infection in man in Thailand,
phylogenetic tree obtained shows that despite the 1962–1964. I. Observations on hospitalized patients with haemor-
rhagic fever. Am J Trop Med Hyg 18:954–971.
presence of many Asian isolates the African viruses
Page RDM. 1996. Tree view: an application to display phylogenetic
diverged earliest. The Malaysian strains isolated trees on personal computers. Cabios 12:357–358.
during the epidemics of 1998 fell into a cluster along Pfeffer M, Proebster B, Kinney RM, Kaaden OR. 1997. Genus-specific
with other members of the Asian genotype. It would detection of alphavirus by a semi-nested reverse transcription-
polymerase chain reaction. Am J Trop Med Hyg 57:709–718.
appear that the nsP1 primer set would be suitable for
Powers AM, Brault AC, Tesh RB, Weaver SC. 2000. Re-emergence of
diagnostic purposes, whereas the E1 primer set could chikungunya and o’nyong-nyong viruses: evidence for distinct
be applied for genotyping of Chikungunya strains. geographical lineages and distant evolutionary relationships. J
Gen Virol 81:471–479.
Rao TR. 1971. Immunological surveys of arbovirus infections in South-
East Asia, with special reference to dengue, chikungunya, and
REFERENCES Kyasanur Forest disease. Bull WHO 44:585–591.
Adesina OA, Odelola HA. 1991. Ecological distribution of Chikun- Saitou N, Nei M. 1987. The neighbor-joining method: a new method for
gunya haemagglutination inhibition antibodies in human and reconstructing phylogenetic trees. Mol Biol Evol 4:406–425.
domestic animals in Nigeria. Trop Geogr Med 43:271–275. Schmitz H, Emmerich P, ter Meulen J. 1996. Imported tropical virus
Carey DE. 1971. Chikungunya and dengue: a case of mistaken infections in Germany. Arch Virol 11(suppl):67–74.
identity? J Hist Med Allied Sci 26:243–262. Seah CL, Chow VT, Tan HC, Can YC. 1995. Rapid, single-step RT-
Chungue E, Roche C, Lefevre MF, et al. 1993. Ultra-rapid, simple, PCR typing of dengue viruses using five NS3 gene primers. J Virol
sensitive, and economical silica method for extraction of dengue Methods 51:193–200.
viral RNA from clinical specimens and mosquitoes by reverse Sudiro TM, Ishiko H, Green S, et al. 1997. Rapid diagnosis of dengue
transcriptase-polymerase chain reaction. J Med Virol 40:142– viremia by reverase transcriptase-polymerase chain reaction
145. using 30 -noncoding region universal primers. Am J Trop Med
Diallo M, Thonnon J, Traore–Lamizana M, Fontenille D. 1999. Hyg 56:424–429.
Vectors of Chikungunya virus in Senegal: current data and Thaikruea L, Cheareansook O, Reanphumkarkit S, et al. 1997.
transmission cycles. Am J Trop Med Hyg 60:281–286. Chikungunya in Thailand: a re-emerging disease? Southeast
Eisenhut M, Schwarz TF, Hegenscheid B. 1999. Seroprevalence of Asian J Trop Med Public Health 28:359–364.
Dengue, Chikungunya and Sindbis virus infections in German aid Thein S, La Linn M, Aaskov J, et al. 1992. Development of a simple
workers. Infection 27:82–85. indirect enzyme-linked immunosorbent assay for the detection of
Felsenetein J. PHYLIP (Phylogeny Inference Package) Version 3.5c. immunoglobulin M antibody in serum from patients following an
1993. Distributed by the author. Seattle, WA: Department of outbreak of Chikungunya virus infection in Yangon, Myanmar.
Genetics, University of Washington. Trans R Soc Trop Med Hyg 86:438–442.
Halstead SB, Nimmannitya S, Margiotta MR. 1969. Dengue and Thonnon J, Spiegel A, Diallo M, et al. 1999. Chikungunya virus out-
Chikungunya virus infection in man in Thailand, 1962–1964. II. break in Senegal in 1996 and 1997. Bull Soc Pathol Exot 92:79–82.
Observations on disease in outpatients. Am J Trop Med Hyg Thuang U, Ming CK, Swe T, Thein S. 1975. Epidemiological features
18:972–983. of dengue and chikungunya infections in Burma. Southeast Asian
Harnett GB, Bucens MR. 1990. Isolation of chikingunya virus in J Trop Med Public Health 6:276–283.
Australia. Med J Aust 152:328–329. Turell MJ, Beaman JR, Tammariello RF. 1992. Susceptibility of
Harris E, et al. 1999. Rapid subtyping of dengue viruses by restriction selected strains of Aedes aegypti and Aedes albopictus (Diptera:
site-specific (RSS)-PCR. Virology 253:86–95. Culicidae) to chikungunya virus. J Med Entomol 29:49–53.You can also read
