Long-Template DNA Polymerase Chain Reaction for the Detection of the bcr/abl Translocation in Patients with Chronic Myelogenous Leukemia1
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
4146 Vol. 5, 4146 – 4151, December 1999 Clinical Cancer Research
Long-Template DNA Polymerase Chain Reaction for the Detection
of the bcr/abl Translocation in Patients with Chronic
Myelogenous Leukemia1
Cornelius F. Waller, Gereon Dennebaum, In 95% of patients the Philadelphia chromosome (Ph) is present
Christoph Feldmann, and Winand Lange2 (1, 2). This is the result of an acquired reciprocal translocation
t(9;22)(q34.1;q11.21) of the c-abl oncogene from chromosome
Department of Internal Medicine I, Hematology/Oncology, Albert
Ludwigs University Freiburg Medical Center, D-79106 Freiburg, 9 to the bcr on chromosome 22 (3). Due to this positioning
Germany effect a patient-specific chimeric fusion gene arises. Usually,
fusion gene products of two slightly different sized mRNAs of
approximately 8.5 kb are expressed, b2a2 and b3a2. Both of
ABSTRACT them encode for a Mr 210,000 fusion protein (p210 bcr/abl), a
In most patients with chronic myelogenous leukemia protein with increased tyrosine kinase activity (4, 5).
(CML) primitive hematopoietic progenitors carry the ac- In the bcr, the translocation occurs somewhere in an intron
quired reciprocal bcr/abl gene rearrangement t(9;22)(q34.1; within a 5.8-kb genomic region (6, 7). In abl, the chromosomal
q11.21). However, not all of the progenitor cells express the breakpoints are dispersed over an intron region as large as about
bcr/abl hybrid mRNA or the p210 fusion protein. These cells, 200 kb (8). Complete intron sequence is available only for the
therefore, might escape detection by techniques that are bcr introns, whereas in abl, approximately 95 kb of the 200 kb
based on expression of the fusion gene. To circumvent this are yet unknown (Fig. 1A).
problem, we established a new detection method for the Two research groups independently reported that primitive
rearrangement at the DNA level. Because breakpoints might CML progenitors carry the rearrangement but do not necessarily
occur in a very large genomic region (>200 kb), we devel- express the bcr/abl hybrid mRNA or the p210 fusion protein (9,
oped a long-template DNA-PCR (LT-DNA-PCR). In 22 of 59 10). Because of this, these cells might escape detection by
CML patients, fragments of up to 19 kb could be amplified. techniques that are based on expression of the fusion gene.
Furthermore, 6 of 7 leukapheresis products of three bcr/abl- Therefore, we intended to establish a method for detection of
positive patients which were collected after mobilization patient-specific rearrangements at the DNA level. Unfortu-
chemotherapy and had been shown to be negative for the nately, the breakpoints in CML are dispersed over such a large
bcr/abl rearrangement by FISH and by RT-PCR were genomic region that at present, it is not possible to cover them
clearly positive by LT-DNA-PCR. Using a specific pair of by conventional PCR methods. In 1994, Cheng et al. (11)
primers, it is possible to detect the presence of, and to showed effective amplification of long targets from human
characterize, the individual gene rearrangement. This ap- genomic DNA using a recombinant Thermus thermophilus
proach could serve for diagnostic purposes as well as detec- DNA polymerase. In accordance with their approach, we de-
tion of minimal residual disease under cytotoxic therapy or signed a set of LT-PCRs with one constant bcr primer and 10 abl
after purging regimens, being independent of expression of primers at a distance of approximately 15 kb each. Depending
the bcr/abl hybrid mRNA or the fusion protein. on the translocation site the first abl primer 39 of the transloca-
tion together with the constant 59 bcr primer should be able to
INTRODUCTION amplify the fusion region (Fig. 1B).
CML3 is a clonal hematological stem cell malignancy.
Usually, a typical peripheral blood count leads to the diagnosis. MATERIALS AND METHODS
Patient Samples. Peripheral blood from 59 patients with
CML, 4 healthy volunteers, 3 control patients and three Ph1
cell-lines (BV 173, K-562, and LAMA 84) were analyzed
Received 5/6/99; revised 8/24/99; accepted 9/10/99. (Table 1). Furthermore, samples from leukapheresis products of
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
three patients with CP-CML collected after mobilization chem-
advertisement in accordance with 18 U.S.C. Section 1734 solely to otherapy consisting of idarubicin, cytosine arabinoside, and
indicate this fact. etoposide were analyzed (Table 3). Samples were drawn after
1
Supported in part by the W. Sander-Stiftung (C.F.W., W.L.), the informed consent was obtained according to institutional guide-
Deutsche Krebshilfe (W61/93/La1), and the Zentrum Klinische For- lines.
schung I, Albert Ludwigs University Freiburg (C.F.W., W.L.).
2
To whom requests for reprints should be addressed, at Department of RNA Isolation. Total cellular RNA from 1 3 105 to 1 3
Hematology/Oncology, University of Freiburg, Hugstetter Strasse 55, 106 cells from peripheral blood or thawed leukapheresis samples
D-79106 Freiburg, Germany. Phone: 49-761-270-3852; Fax: 49-761- was extracted using a RNeasy Total Kit (Quiagen, Hilden,
270-3418; E-mail: Lange@mm11.ukl.uni-freiburg.de. Germany) according to the manufacturer’s instructions.
3
The abbreviations used are: CML, chronic myelogenous leukemia; CP,
chronic phase; Ph, Philadelphia chromosome ; bcr, breakpoint cluster
RT-PCR. RT-PCR amplification using nested primers
region; LT-PCR, long template-PCR; RT-PCR, reverse transcription- was performed according to standard protocols as described
PCR; FISH, fluorescence in situ hybridization. previously (12).
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.Clinical Cancer Research 4147
Fig. 1 A, exon-intron distribution. Map of bcr and abl exon-intron region. The bcr gene with the two exons (b2 and b3) including the 5.8-kb bcr;
abl with exons (1b, 1a, and 2) and the 200-kb breakpoint region. hsablgr refers to GenBank sequences hsablgr1 (access code: UO7561), hsablgr2
(access code: UO7562), hsablgr3 (access code: UO7563); bcr, refers to hsuo7000 (access code: UO7000); dashed line, unknown sequence. B,
primer-location, restriction enzyme recognition sites. Primers A-2 and 3–1 to 3–9 are complementary to abl sequences; primer B2 represents the
constant bcr primer. C, localization of hybridization oligonucleotides within the bcr gene.
Table 1 Patient and LT-DNA-PCR data reagent mix and the sample. The lower reagent mix (40 ml) was
Samples n LT-DNA-PCR-positive composed of 12 ml of 3.3 XL Buffer II; 10 mM dNTPs, 20 pmol
of each abl primer and the bcr B2 primer and 25 mM Mg(OAc)2.
CML, 1st CP 45 21
CML, 2nd CP 4 0 The volume was adjusted to 40 ml with dH20. To this mix, an
CML, AP a 6 1 AmpliWax PCR Gem 100 (Perkin-Elmer) was added and
CML, BC 4 0 melted at 75°C for 5 min. Thereafter, as soon as the wax
CML cell lines 3 1
hardened, the upper reagent mix was placed above the solid wax
Healthy volunteers 4 0
AML 2 0 layer. The upper reagent mix (20 ml) consisted of 18.5 ml of 3.3
Ph1 ALL 1 0 XL Buffer II and 3 units of rTth (recombinant T. thermophilus)
a
AP, accelerated phase; BC, blast crisis; AML, acute myeloid polymerase. The sample was added to the upper reagent mix. It
leukemia; Ph1 ALL, Philadelphia chromosome-positive acute lympho- was composed of 0.5 mg of DNA (in 0.5 ml) and 39.5 ml of
cytic leukemia. dH20. Division of the lower and upper reagent mix allowed a
hot-start technique and ensured that all of the tubes had a
synchronized start time. Cycle conditions were as follows: de-
DNA Isolation. DNA was isolated using 1–10 ml of naturation time for 10 s at 93°C; annealing and extension time,
EDTA-blood or samples from leukapheresis products with a starting at 10 min and increased by 10 s per cycle both at 68°C.
Quiagen Blood and Cell Culture DNA Midi Kit (Quiagen) Thirty-six cycles were performed with a final hold at 72°C for
according to the manufacturer’s instructions. Three 3 107 cells 10 min. All of the steps were performed using a Perkin-Elmer
yielded a median of 97.6 mg genomic DNA, which was dis- DNA Thermal Cycler.
solved in Tris-EDTA buffer (pH 8.0) and stored at 220°C. Restriction Enzyme Digestion. Two ml of 103 restric-
LT-DNA-PCR Primer Design. A constant bcr-primer tion endonuclease buffer, 7 ml of dH2O, and 1 ml of restriction
and 10 abl-primers at a distance of approximately 15 kb each endonuclease (4 –5 units) were added to 10 ml of PCR products
were designed (Fig. 1B). All of the 22-mer primers where and then incubated at 37°C for 60 min. The reaction was stopped
chosen with an annealing temperature of 68.0 – 68.7°C and a GC by adding 0.5 ml of 5 M EDTA buffer (pH 8.0).
content of 50 –55%. Primers were adjusted to 20 pmol per Agarose Gel Electrophoresis. For the analysis of ampli-
reaction. abl genomic localization (Fig. 1B; Table 2A) refers to fied products, agarose gel electrophoresis was performed to
GenBank sequences hsablgr1 (access code (ac): UO7561), visualize PCR products. Fifteen ml of the amplification product
hsablgr2 (ac: UO7562), hsablgr3 (ac: UO7563) and bcr to were loaded per lane and run at a constant voltage of 80 V. A
hsuo7000 (ac:UO7000). The sequence of used primers is shown 0,8% SeaKemGold Agarose gel (FMC BioProducts, Rockland,
in table 2A. ME) was used and stained with ethidium bromide.
LT-PCR. Initially, a set of ten PCR reactions per patient Hybridization with Specific bcr Probes and DNA Se-
was performed. After identification of a patient characteristic quencing. Aliquots of amplified products were dot-blotted
amplification product the specific primer combination was used and hybridized with eight digoxigenin probes about 400 bp apart
for subsequent analysis. A Perkin-Elmer GeneAmp XL PCR Kit spanning the bcr region between exons 13 and 15 (Fig. 1C). The
(Perkin-Elmer, Foster City, CA) was used. Briefly, the reaction DIG easy Hyb system (Boehringer, Mannheim, Germany) to
mix (100 ml) is divided into a lower reagent mix, the upper detect complementary sequences was used according to the
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.4148 LT-DNA-PCR for bcr/abl in Patients with CML
Table 2 Primer and sequence data
Primer Locationa Sequence 59–39 Position (GenBank)
A. Primer locations, sequences, and genomic positions
B2 bcr exon b2 CAGAAGCTTCTCCCTGACATCC hsuo7000; 123599–123620
A2 abl exon a2 ATTATAGCCTAAGACCCGGAGC hsablgr3; 50667–50646
3-1 abl intron 1b CTGGATCTGAAGCTCCCAGATG hsablgr3; 34346–34325
3-2 abl intron 1b TTTCCCCTGATCAGTCTGGGTA hsablgr3; 16817–16796
3-3 abl intron 1b GCCATGGGAGAAGAATATCCCG hsablgr3; 228–207
3-4 abl intron 1b CCATGCCCACATTCAGGACTTG hsablgr2; 58991–58970
3-5 abl intron 1b CTACCAACTTCACACCAGCCTG hsablgr2; 44891–44870
3-6 abl intron 1b GGGAGAGAGAAAAGACCATGGG hsablgr2; 29633–29612
3-7N abl intron 1b TGGAACAAGGGGTCAGAGTGAT hsablgr2; 15276–15255
3-8 abl intron 1b TGGTCTCCACTATTCAAGGGACA hsablgr2; 318–297
3-9N abl intron 1b CACCCCCATATCCCACATCTAA hsablgr1; 35766–35745
B. Hybridization primer locations and sequences
hyb0 bcr intron 13 TCAGATGCTC TGTGCCTT hsuo7000; 123606–123623
hyb1 bcr intron 13 ACACAGTGTC CACCGGAT hsuo7000; 123955–123972
hyb2 bcr intron 13 CCTGCAGGTG GATCGAGT hsuo7000; 124377–124394
hyb3 bcr intron 14 TGAGTTGCAC TGTGTAAG hsuo7000; 124618–124635
hyb4 bcr intron 14 TTAGGTGAGA GCAGTGTC hsuo7000; 125047–125064
hyb5 bcr intron 14 CATGGCCAAG CCAGAAAC hsuo7000; 125474–125491
hyb6 bcr intron 14 TACACCTCTC TGTCCCCA hsuo7000; 125930–125945
hyb7 bcr intron 14 GCGTCTACAG GGACACAG hsuo7000; 126319–126336
a
abl genomic localization refers to GenBank sequences hsablgr1 (access code (ac): UO7561), hsablgr2 (ac: UO7562), hsablgr3 (ac: UO7563);
bcr genomic location refers to hsUO7000 (ac: UO7000).
manufacturer’s instructions. The most 39-located probe that points on the abl gene could be located in published sequences,
gave a positive signal was subsequently used as sequencing whereas in one sample a localization was impossible (Fig. 3).
primer for sequence analysis of the breakpoints at the 39 end of In DNA dilution experiments, the sensitivity of our LT-
the bcr gene and the 59 end of the abl gene. Sequence analysis PCR method was determined to be 25 pg, the DNA content of
was performed by PCR cycle sequencing using the Big Dye approximately four primary CML cells (Fig. 4A) or the equiv-
Terminator Cycle Sequencing Ready Reaction (PE Applied alent of four BV173 cells (data not shown; a fragment of ,1 kb
Biosystems, Foster City, CA) with an automated sequencer was amplified). RT-PCR was able to detect the RNA equivalent
(DNA Sequencer, model 373A, PE Applied Biosystems). of about one cell (Fig. 4B).
FISH. Cells from leukapheresis products were analyzed Six of seven leukapheresis products from three patients that
by interphase FISH for quantitation of Ph1 cells as described repeatedly had been found to be negative for the bcr/abl rear-
previously (13). The threshold of detection was determined at rangement by RT-PCR and interphase FISH were clearly posi-
.6% to classify any specimen as Ph-positive. FISH was per- tive by LT-DNA-PCR (Fig. 5). Only one of seven apheresis
formed using a DNA probe mixture for the Mbcr/abl translo- products was constantly negative by all three of the methods
cation (Oncor, Gaithersburg, MD) according to the manufactur- (Table 3). All three of the patients were positive by RT-PCR for
er’s instructions. bcr/abl before mobilization chemotherapy.
RESULTS DISCUSSION
In 22 (37.3%) of 59 CML patients, fragments of up to 19 A point of controversy is the question whether all of the
kb could be amplified by LT-PCR showing an individual patient CML cells actively express the hybrid fusion gene or not (14).
characteristic PCR product (Table 1). The breakpoints were Primitive CML progenitor cells were shown to be RT-PCR-
dispersed throughout intron 1b without any obvious clustering. negative despite carrying the bcr/abl translocation. In these
In one patient, the breakpoint was in intron 1a. With the excep- cells, bcr/abl mRNA might be either absent or minimally ex-
tion of primer 3–3, 3–7, and 3– 8, every abl primer generated pressed. Antisense oligonucleotides targeted against the hybrid
fragments in selected patients. To prove the identity of the mRNA might, therefore, not be effective as eradication tech-
amplified fragments, restriction endonuclease digestion was niques (9). A second research group reported that 23% of Ph1
used in four patients. Fragments matching exactly the calculated myeloid colonies were found to be bcr/abl mRNA-negative
size according to the available sequence information could be (10). Both of the studies have been criticized because of their
generated (Fig. 2). inadequate controls for cDNA synthesis (15, 16).
In addition, nine of the amplified products were further Now that we are able to use PCR at the DNA level, the
characterized by sequence analysis. In eight samples, the break- presence of gene expression as mRNA or protein is no prereq-
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.Clinical Cancer Research 4149
Fig. 4 A, sensitivity of LT-DNA-PCR. An approximately 4400-bp
fragment could be generated with the constant bcr primer and abl primer
3–5 in one representative patient with 100% Ph1 hematopoiesis at the
time of analysis. On the basis of sequence analysis, the calculated size
is 4341 bp. For amplification, a dilution series of template DNA was
used as follows: Lane 2: 0.25 mg; Lane 3: 25 ng; Lane 4: 2.5 ng; Lane
5: 250 pg; Lane 6: 25 pg; Lane 7: 2.5 pg; Lane 8: 250 fg; Lane 9: 25 fg;
Lanes 10 and 11: not loaded; Lanes 1 and 12: lHindIII. B, sensitivity of
RT-PCR. For amplification, a dilution series of BV173 mRNA was used
as follows: Lane 2: 5 mg; Lane 3: 500 ng; Lane 4: 50 ng; Lane 5: 5 ng;
Fig. 2 Agarose gel electrophoresis of one representative patient sam- Lane 6: 500 pg; Lane 7: 50 pg; Lane 8: 5 pg; Lane 9: 0.5 fg; Lanes 1 and
ple. A characteristic fragment of approximately 6000 bp could be 10: fX174/HAEIII.
amplified with the constant bcr primer and the abl primer 3–2 (Lane 2).
Restriction enzyme digestion produced fragments of approximately
5400 bp and 600 bp, respectively. On the basis of sequence information,
the calculated size of the smaller fragment is 614 bp. Lanes 1 and 4,
lHindIII. In comparison with RT-PCR, the DNA LT-PCR offers
certain advantages. Because of the independence of gene ex-
pression, genomic DNA could be more informative for the
detection of residual disease or for very immature selected
progenitors (14). A technical advantage of LT-PCR is the han-
dling of stable DNA instead of RNase sensitive RNA and using
patient-specific primers would help to minimize the problem of
PCR contamination. In this first study, we used a set of indi-
vidual LT-PCR reactions to show the feasibility of the method-
ology. In future studies, however, multiplex LT-PCR with all of
Fig. 3 Breakpoint localization in the abl gene. Individual breakpoints
were dispersed throughout the entire abl intron sequence without clus- the different primer pairs in the same reaction tube might
tering. facilitate the practicability of this approach.
To our knowledge, only about one-half of the sequence
of the involved part of the abl gene is known (Fig. 1).
uisite for positive testing. There have been earlier attempts to Nevertheless, it was possible to amplify the breakpoint region
establish detection methods at the DNA level. A bubble PCR in more than one-third of the examined samples. In addition,
technique was described to facilitate cloning of bcr/abl break- further characterization of the amplified products by endo-
points (14). DNA from patients with CP-CML was diluted into nuclease restriction digest in four patients and sequence
normal DNA and subjected to two-step PCR. It is necessary to analysis at the breakpoint were successful in eight of nine
clone and sequence the breakpoint from each patient and to analyzed samples. Once the complete intron sequence of abl
design patient specific oligonucleotide primers. Therefore, this will be available, every breakpoint should be representable
technique involves an appreciable amount of time and effort after appropriate primer design. With reference to the break-
and, in addition, has a lower sensitivity than RT-PCR (17). On point site in the abl gene, our results do not yet support data
the other hand, the new LT-PCR is an easy way to perform a published by Jiang et al. (18). In our findings, the breakpoints
one-step PCR, once a patient-specific primer pair has been were equally dispersed over intron 1b and did not cluster,
identified. whereas Jiang et al. suggested three cluster regions—30 6 5,
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.4150 LT-DNA-PCR for bcr/abl in Patients with CML
Table 3 Analysis of leukapheresis products
Patient Apheresis
no. no. FISH RT-mRNA-PCR LT-DNA-PCR
1 1 Negative Negative Positive
2 Negative Negative Positive
3 Negative Negative Negative
2 1 Negative Negative Positive
2 Negative Negative Positive
3 1 Negative Negative Positive
2 Negative Negative Positive
disease even in the absence of gene expression in CML patients.
It will probably improve the evaluation of purging strategies in
CML. In addition, a modification of the methodology could also
be used to detect breakpoints associated with Ph-positive acute
lymphocytic leukemia.
Fig. 5 Apheresis sample analysis. Analysis of two apheresis samples ACKNOWLEDGMENTS
each of patients S. I. (Lanes 2 and 3) and H. G. (Lanes 4 and 5). We thank J. Fischer and A. Rosenstiel for excellent technical
Molecular weight marker in Lane 1. a, abl mRNA RT-PCR to control assistance. Also we would like to acknowledge Dr. M. Follo for se-
integrity of the RNA preparation. All of the samples are positive; bands quence analysis.
at 106 bp. b, bcr/abl mRNA RT-PCR to detect the b2a2 or b3a2 mRNA.
All of the samples are negative; no bands at 234 bp. c, bcr/abl LT-
DNA-PCR; for patient S. I., primers abl 3–2 and bcr B2 and, for patient REFERENCES
H. G., primers abl 3– 4 and bcr B2 were used to generate amplification 1. Carella, A. M., Frassoni, F., Melo, J., Sawyers, C., Eaves, C., Eaves,
products of approximately 6.0 kb (Lanes 2 and 3 and Lanes 4 and 5, A., Apperley, J., Tura, S., Hehlmann, R., Reiffers, J., Lerma, E., and
respectively. Goldman, J. New insights in biology and current therapeutic options for
patients with chronic myelogenous leukemia. Haematologica, 82: 478 –
495, 1997.
2. Gale, R. P., Grosveld, G., Canaani, E., and Goldman, J. M. Chronic
myelogenous leukemia: biology and therapy. Leukemia (Baltimore), 7:
100 6 13, and 135 6 8 kb— downstream from exon 1b. In 653– 658, 1993.
one case, the breakpoint was identified in intron 1a, a finding 3. Bartram, C. R., de Klein, A., Hagemeijer, A., van Agthoven, T.,
previously reported in three other patients (7, 17). Neverthe- Geurts van Kessel, A., Bootsma, D., Grosveld, G., Ferguson-Smith,
less, because of the relatively small number of cases exam- M. A., Davies, T., Stone, M., Heisterkamp, N., Stephenson, J. R., and
Groffen, J. Translocation of the c-abl oncogene adjacent to a translo-
ined, these findings should not be overrated. A potential cation break point in chronic myelocytic leukemia. Nature (Lond.), 306:
disadvantage of LT-DNA-PCR could be single-copy target 277–280, 1983.
amplification, whereas, in RT-PCR, high expression per sin- 4. Konopka, J. B., and Witte, O. N. Detection of c-abl tyrosine kinase
gle cell might allow potentially more sensitive detection. activity in vitro permits direct comparison of normal and altered abl
However, our results comparing RT- versus LT-DNA-PCR gene products. Mol. Cell. Biol., 5: 3116 –3123, 1985.
showed comparable sensitivity no matter whether large or 5. Shtivelman, E., Lifshitz, B., Gale, R. P., and Canaani, E. Fused
transcript of abl and bcr genes in chronic myelogenous leukemia.
small fragments were amplified from DNA templates. Nature (Lond.), 315: 550 –554, 1985.
LT-PCR analysis of seven leukapheresis products of three 6. Groffen, J., Stephenson, J. R., Heisterkamp, N., de Klein, A., Bar-
CP-CML patients after mobilization chemotherapy showed re- tram, C. R., and Grosveld, G. Philadelphia chromosomal breakpoints are
producibly the presence of bcr/abl at the DNA level in six of clustered within a limited region, bcr, on chromosome 22. Cell, 36:
them whereas analysis by RT-PCR and FISH failed to detect the 93–99, 1984.
fusion gene. The sensitivity of FISH does not allow detection of 7. Heisterkamp, N., Stam, K., Groffen, J., de Klein, A., and Grosveld,
the rearranged bcr/abl gene unless .5% of rearranged cells are G. Structural organization of the bcr gene and its role in the Ph9
translocation. Nature (Lond.), 315: 758 –761, 1985.
present within the analyzed cell population, a percentage also
8. Bernards, A., Rubin, C. M., Westbrook, C. A., Paskind, M., and
comparable to classical cytogenetic analysis. This fact is well Baltimore, D. The first intron in the human c-abl gene is at least 200
known from patients receiving a-IFN therapy who become kilobases long and is a target for translocations in chronic myelogenous
negative by cytogenetics or FISH, but are still positive by RT-PCR. leukemia. Mol. Cell. Biol., 7: 3231–3236, 1987.
Considering the sensitivity of RT-PCR and LT-DNA-PCR about 9. Bedi, A., Zehnbauer, B. A., Collector, M. I., Barber, J. P., Zicha,
equal, our results imply either that some rearranged cells do not M. S., Sharkis, S. J., and Jones, R. J. BCR-ABL gene rearrangement and
expression of primitive hematopoietic progenitors in chronic myeloid
express the bcr/abl fusion gene or that the expression is rather low, leukemia. Blood, 81: 2898 –2902, 1993.
possibly just below the detection limit of RT-PCR. 10. Keating, A., Wang, X. H., and Laraya, P. Variable transcription of
The data that is shown support the usefulness of our BCR-ABL by Ph1 cells arising from hematopoietic progenitors in
method as a diagnostic tool and as a means to detect residual chronic myeloid leukemia. Blood, 83: 1744 –1749, 1994.
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.Clinical Cancer Research 4151
11. Cheng, S., Fockler, C., Barnes, W. M., and Higuchi, R. Effective 15. Cross, N. C., Lin, F., and Goldman, J. M. Appropriate controls for
amplification of long targets from cloned inserts and human genomic reverse transcription polymerase chain reaction (RT-PCR). Br. J.
DNA. Proc. Natl. Acad. Sci. USA, 91: 5695–5699, 1994. Haematol., 87: 218, 1994.
12. Maurer, J., Kinzel, H., Nentwig, T., and Thiel, R. Molecular diag- 16. Melo, J. V., Kent, N. S., Yan, X. H., and Goldman, J. M. “Controls
nosis of the Philadelphia chromosome in chronic myelogenous and for reverse transcriptase-polymerase chain reaction amplification of
acute lymphoblastic leukemia by PCR. Disease Markers, 8: 211–218, BCR-ABL transcripts” (Letter). Blood, 84: 3984 –3986, 1994.
1990.
17. Zhang, J. G., Lin, F., Chase, A., Goldman, J. M., and Cross, N. C.
13. Heinzinger, M., Waller, C. F., Rosenstiel, A., Scheid, S., Burger, Comparison of genomic DNA and cDNA for detection of residual
K. J., and Lange, W. Quality of IL-3 and G-CSF-mobilized peripheral disease after treatment of chronic myeloid leukemia with allogeneic
blood stem cells in patients with early chronic phase CML. Leukemia
bone marrow transplantation. Blood, 87: 2588 –2593, 1996.
(Baltimore), 12: 333–339, 1998.
18. Jiang, X. Y., Trujillo, J. M., and Liang, J. C. Chromosomal break-
14. Zhang, J. G., Goldman, J. M., and Cross, N. C. Characterization of
genomic BCR-ABL breakpoints in chronic myeloid leukemia by PCR. points within the first intron of the ABL gene are nonrandom in patients
Br. J. Haematol., 90: 138 –146, 1995. with chronic myelogenous leukemia. Blood, 76: 597– 601, 1990.
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.Long-Template DNA Polymerase Chain Reaction for the
Detection of the bcr/abl Translocation in Patients with Chronic
Myelogenous Leukemia
Cornelius F. Waller, Gereon Dennebaum, Christoph Feldmann, et al.
Clin Cancer Res 1999;5:4146-4151.
Updated version Access the most recent version of this article at:
http://clincancerres.aacrjournals.org/content/5/12/4146
Cited articles This article cites 18 articles, 9 of which you can access for free at:
http://clincancerres.aacrjournals.org/content/5/12/4146.full#ref-list-1
Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at:
http://clincancerres.aacrjournals.org/content/5/12/4146.full#related-urls
E-mail alerts Sign up to receive free email-alerts related to this article or journal.
Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Subscriptions Department at pubs@aacr.org.
Permissions To request permission to re-use all or part of this article, use this link
http://clincancerres.aacrjournals.org/content/5/12/4146.
Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
Rightslink site.
Downloaded from clincancerres.aacrjournals.org on January 12, 2021. © 1999 American Association for Cancer
Research.You can also read
