Molecular detection of some tetracycline-resistant genes in Staphylococcus aureus isolated from sheep milk in Al- Qadisiyah province of Iraq
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
EurAsian Journal of BioSciences
Eurasia J Biosci 14, 1161-1166 (2020)
Molecular detection of some tetracycline-resistant genes
in Staphylococcus aureus isolated from sheep milk in Al-
Qadisiyah province of Iraq
Ghassan Khudhair Esmael 1*, Noor Mahmood Majeed 2
1
Veterinary Medicine College, University of Al-Qadisiyah, IRAQ
2
Dentistry College, University of Al-Qadisiyah, IRAQ
*Corresponding author: Ghassan.khudhair@qu.edu.iq
Abstract
Our study aims to investigate some tetracycline resistance genes in isolates of Staphylococcus
aureus that collected from ewes milk that collected randomly. Sixty Milk samples are taken from ewes
randomly and submitted to culturing on blood agar then submitted to PCR methods for final
confirming detection of Staphylococcus aureus by using specific primers designed for (Glpf) gene
depending on NCBI and Primer3 then making sensitivity test for tetracycline then make PCR for
detection of some tetracycline resistance genes. Our results showed positive samples for
Staphylococcus aureus was 14/60 (23.3%) by using PCR. Besides, all Staphylococcus aureus
isolates were submitted to the tetracycline sensitivity test (disk diffusion method (Kirby‐Bauer) by
tetracycline. Moreover, showing the percentage of tetracycline resistance isolates was 8/14(57.1%),
and tetracycline sensitive isolates were 6/14 (42.8 %). Also, our results showed the percentage of
tetracycline resistance genes tet(L) and tet(k) were 9/14 (64.2%) and 7/14 (50%) respectively, and
percentage of isolates that carry gene tet(L) and tet(K) together was 2/14 (14.2)% by using
polymerase chain reaction technique. Our study concluded ewes milk that contaminated by
Staphylococcus aureus at a high rate, and the non-response to treatment by tetracycline is occurred
due to present tetracycline resistance genes such as tet(L) and tet(k), were causes treatment failure
by tetracycline.
Keywords: tetracycline resistance genes, ewes, Staphylococcus aureus, PCR
Esmael GK, Majeed NM (2020) Molecular detection of some tetracycline-resistant genes in
Staphylococcus aureus isolated from sheep milk in Al-Qadisiyah province of Iraq. Eurasia J Biosci
14: 1161-1166.
© 2020 Esmael and Majeed
This is an open-access article distributed under the terms of the Creative Commons Attribution License.
INTRODUCTION from tetracycline such as doxycycline and minocycline
(Ardic et al. 2005, Chopra and Roberts 2001, Kareem et
The infections that result from antibiotic-resistant al. 2017).
bacteria are one of the risks cases that must be studied There are many tetracycline resistance genes
and identify as soon as possible. Staphylococcus aureus detected nearly (40) acquired tetracycline resistance
is known to be one of the major causes of infections genes, theses gene enhance the bacteria to resist the
acquired in humans and animals worldwide and is one treatment by the tetracycline by several mechanisms are
of the most common organisms associated with mastitis including efflux proteins, tetracycline enzymatic
infections in female animals (Bertrand et al. 2002, inactivation and bacterial ribosomal protection proteins
Almobarak et al. 2020). (Roberts 2005).
When starting using the antibiotics in treatment, S. Most of the tetracycline-resistant organisms are (tet).
aureus revealed great development by mutation by There are two mechanisms for of tetracycline resistance
producing antibiotic resistance for all antibiotics nearly found in S. aureus are efflux, the occur due to activity of
(Boucher and Corey 2008). tet(K) or tet(L) genes while bacterial ribosomal
Tetracyclines are wide common antibiotics used in protection occurs due to activity of tet(M) or tet(O) gene
the prevention and treatment of the bacterial diseases (Esposito et al. 2009, McCallum et al. 2010).
Gram-positive and negative. It discovered in 1940 and
used from this date continuously in animals and humans
without negative side effects. Tetracyclines stop
Received: November 2019
bacterial growth by inhibition of the ribosome activity
Accepted: April 2020
leading to stopping protein synthesis. After that date, the
Printed: May 2020
development of several chemical substances is derived
1161
EurAsian Journal of BioSciences 14: 1161-1166 (2020) Esmael and Majeed
The tetracycline resistance genes are cause Table 1. The used Instruments and Equipment in our study
antibiotic resistance in bacteria, which acquired from Number Apparatus The company
1 Light microscope Olympus (Japan)
carrying germs that carry on plasmid and transposons. 2 Incubator Memmert (Germany)
This continuous, long and randomly using the antibiotics 3 Autoclave Trilp (Italy)
4 Centrifuge Hettish (Germany)
are leading to selective pressure on the bacteria and the 5 Sensitive balance Sartorius (Germany)
microflora. Tetracycline resistance genes are many 6. Thermo cycler Techne (USA)
including tetK, tetL, tetM and tetO, it is associated with 7 electrophoresis (UK)
8 Refrigerator Kiriazi (Egypt)
most bacteria. The tetL and tetK encoding the efflux 9 Hood LabTech (USA)
proteins which attach to the external surface of the 10 Benzene flame Sartorius (Germany)
11 Ultra centrifuge Yagamy (Japan)
bacteria that prevent tetracycline from getting inside the
12 Plastic test tubes AFCO, Jordan
bacteria (Huys et al. 2005). While tet(M) and tet(O) 13 Vortex Yagamy (Japan)
genes encoding ribosomal protection proteins that 14 gel electrophoresis (UK)
15 Digital camera Genix (china)
decrease the affinity of the tetracycline to the ribosome 16 UV-transilluminator (UK)
(Bismuth et al. 1990). Many studies detected many tet 17 DNA extraction tubes China
genes in the world country. In 2006, Jones et al found 1. Glass beakers Hysil (UK)
19 Micropipettes Eppendrof (Germany)
tet(K) was (74.0) % and tet(M) was (13.0) % in S. aureus
(Jones et al. 2006).
Table 2. The used substances in the study
Aim of our study is investigating about
epidemiological aspects of the tetracycline resistance
genes types in isolates of staphylococcus aureus that
isolated from ewe milk.
MATERIALS AND METHODS
Sample Collection
Sixty milk samples collected from ewes randomly; it
is taken from different areas of al Al-Diwaniya province
(Al Hamza, Al-Senia, Summer, Daghara, Shamia, Afuq).
The milk samples were collected in sterile tube (5) ml. Media
The procedure of collection of the milk samples is done
according to methods of as follows: Blood agar base
1- Cleaning the udder wall by brushing off any dirt or Used for bacterial isolation. It Prepared by dissolve
mud then udder was washed by a clean cloth. 40 gms of the powder in distal water (1) L, and pH (7,4)
2- Disinfectant solution (ethanol 70%) and the udder and boiling for complete dissolving, then sterilization by
was allowed to dry and disinfect the teat orifice with a autoclaving at (121) C° in pressure (15) for one quarter,
tincture iodine solution, allowed to be dried. then agar was cooled to (50) C and adding (5-10) % of
3- Discarded first drops of milk and tincture iodine sheep blood, mixed gently and poured into Petri dishes.
dried and labeled septic tubes to ewes and quarters. The substances are shown in Table 2.
4- Small screw–cap vials are carefully removing and The Primers
held between the fingers and the tube should lie at a The oligonucleotide primers for the detection of
slight angle to prevent contamination of the teat orifice. Streptococcus agalactiae (Glpf) gene while,
5- Collection the samples were transported to the oligonucleotide primers for antibiotics resistance genes
laboratory in Al-Qadissiya University lab by cooling box. were designed in this study from the published
Study Design sequence for tet(L) and tet(K) gene in NCBI-Gene Bank.
The samples were cultured on enrichment media All primers prepared in (Bioneer, Korea) company as
(blood agar) directly by swabbing and incubate at Table 3.
incubator at (37) C for (24-48) hours for culture then PCR Technique
PCR is used for confirming the diagnosis of 1- PCR
staphalococcus aeureus by using specific primers for PCR was performed for confirmative detection of
(Glpf) gene, then the positive samples tested by PCR for staphalococcus aeurues by (Glpf) gene, and detection,
detection tet(L)and tet(K). which strains have tetracycline antibiotics resistances
The Materials genes such as tet(L) and tet(K).
Apparatus is shown in Table 1. 2- Genomic DNA extraction
DNA of staphalococcus aeurues was prepared by
using a special Kit called the genomic DNA as:
3-DNA profile
1162
EurAsian Journal of BioSciences 14: 1161-1166 (2020) Esmael and Majeed
Table 3. Used Primers in this study Table 5. Temperature and number of repeat cycles for each
Gene name Primer sequence
Primer phase
size
Glpf F CAATGGGTGTGTTTGCTGTC
Housekeeping
R AGCCGGTGCTGTAGAGAAAA 233 bp
gene
F AAATTGTTTCGGGTCGGTAA
tet(L) 537 bp
R ATTCCCCCACAAAGAACTCC
F TGAGCTGTCTTGGTTCATTGAT 209 bp
Tet(K)
R TGAAGGACCTAACCCTTCACC
Table 4. Components of PCR master mix reaction
Table 6. Number and percentage of glpf gene carry isolates
by using PCR
Fig. Gene
2. Band on N0.
agarose gelTotal
indicate to tet(k) gene by
Percentage
electrophoresis,
glpf wherever
14 (1-5)60mean the positive
23.3%sample
at (209) bp, and M means the PCR marker
The electrophoresis is used for the preparation of
DNA by using agarose gel (1.5) % as following steps:
1- Agarose gel was prepared by adding buffer with
water in (100) °C for fifteen minutes, then cooled.
2- Ethidium bromide (3) µl was mixed with agarose.
3- Pouring agarose in a tray after fixing the comb in
its position, then, left to be solid, and then
removing the comb. DNA (10) µL was added to
all well.
4- The tray was linked with electrophoresis and
Fig. 3.
1. Band
Band on
on agarose
agarose gel
gel indicate
indicatesto to
tetglpf
(L) gene by
adding a buffer. Then electric current was
(1-6) mean the positive sample
electrophoresis, wherever (1-5)
performed at 100 volts and 80 AM for one hour. at (233)
(537) bp, and M means
means the
the PCR
PCR marker.
marker (Housekeeping
5- Band was visualized by using the UV apparatus. gene) F primer = caatgggtgtgtttgctgtc, R primer =
4- PCR master mix preparation agccggtgctgtagagaaaa
The PCR master mix was prepared by using
(AccuPower PCR PreMix Kit) depended on Table 7. Number and percentage of resistance and
manufactured directions in Table 4. sensitive isolates depending on sensitivity test
The DNA template and primers were added into the Isolates Resistance Sensitive
N % NO. % NO. %
standard PCR master mix tube which is PCR PreMix it 14 100 9 64.2 6 42.8
is lyophilized materials that the containing including (Taq Table 8. Incidence of tet(L), tet(K) genes according to our
DNA enzyme, Tris-HClpH:9, MgCl2, dNTPs, KCl, and study by using PCR
stain). Adding water on all the tubes for completing to be Gene Number Percentage
Tet(L) 9/14 64.2%
volume (20) ul and mixed. Tet(k) 7/14 50%
PCR Thermocycler Tet(L)+ tet(K) 2/14 14.2%
The PCR thermocycler setting of Glpf gene, tet (L)
and tet (K) were performed by using an optimized PCR specific primers of (Housekeeping gene) glpf gene were
protocol writer online and done by conventional PCR 14/60 (23.3%) % as Table 6 and Fig. 1.
thermocycler system as following in Table 5. After that, the sensitivity test (Phenotypic) is made on
After that, PCR product transferred into (1.5%) Mueller-Hinton by using tetracycline discs on the media
agarose gel. to determine (sensitive, resistance), according to our
Statistical Analysis results (according to NCCL instructions), (11) isolate
The data was analyzed by using the Chi-square test, showed resistance to tetracycline, and (3) isolates
(p ≤ 0.05) as a criterion for significance. showed sensitive to tetracycline as Table 7.
According to our results, by using PCR, (9) isolates
RESULTS have tet(L) gene, (7) isolates have tet(K) gene and (2)
isolates have tet(L) gene and tet(K) gene together as
60 Milk samples were taken randomly from ewes Table 8 and Figs. 2 and 3.
(clinical and subclinical cases), percentage of PCR There are overlap and intersection between
positive samples of Staphylococcus aureus by using sensitivity test (phenotypic) and polymerase chain
reaction (genotypic), the details showed as Table 9.
1163EurAsian Journal of BioSciences 14: 1161-1166 (2020) Esmael and Majeed
Table 9. The relationship between the results of the (more than our results) was tetracycline resistance
phenotypic (sensitivity test) and the genotypic (PCR test) isolates was (98.2) (Gitau et al. 2018).
Isolates Phenotypic Genotypic
N. Sensitivity test PCR The prevalence of resistant isolates for tetracycline
1 R Tet(L) can vary among the countries and the hospitals, and it
2 S Tet(L) varies between several departments in the same
3 R Tet(L)+ Tet(K)
4 S Tet(k) hospital (Robicsek et al. 2008, Gordon and Lowy 2008).
5 S Tet(L) Tetracycline have low toxicity, therefore it used
6 S Tet(k)
7 R Tet(L)
commonly in the treatment of the many diseases such
8 R Tet(k) as chlamydia, mycoplasmas and rickettsia (Mandell et
9 R Tet(L)+Tet(k) al. 2015).
10 R Tet(k)
11 S Tet(L) Tetracycline efflux protein detected in Gram-negative
12 R Tet(k) and Gram-positive bacteria. Our results showed the
13 S Tet(L) percentage of tet (L) and tet(k) (tetracycline resistance
14 R Tet(L)
genes) were 9/14 (64.2%) and 7/14 (50%) by using
polymerase chain reaction respectively.
Many studies showed low prevalence of tet (K) gene
DISCUSSION in Staphylococcus aureus such as Emaneini et al.
The scientific world gives great attention to (2013), Trzcinski et al. (2000) and Arabzadeh et al.
antibiotics resistance by bacteria, our study is interested (2018) were found 17.2%, 34% and 48% respectively,
in this aim. Also, it showed the percentage of isolates of while Li et al. (2019) recorded tet (K) gene 91.8% more
Staphylococcus aureus by using polymerase chain than our results.
reaction was (23.3%) that isolated from sheep’s milk. Several reports covered the topics that related with
Some the reports showed agreement with our study, prevalence tet (L) gene in Staphylococcus aureus,
wherever were (21%) and (26.7%) by Ahmadi et al. wherever Hedayatianfard et al. (2014), Arabzadeh et al.
(2010) and Tripathi et al. (2006), That considered close (2018) and Rodriguez-Avial et al. (2003.) found tet (L)
to our results, while (Andrés et al. 2017) recorded gene were 0.05%, 3.3% and 0.018% respectively, all
percentage (1.7%) less than our results, while Al- these results less than our results. Prevalence of tet (K)
Anbagi and Kshash (2013) and Velasco et al. (2014) and tet (L) determined and compared with other studies
found prevalence more than our results (92.6%) and may be different geographic regions among the studies
(40%) respectively. and prevalence of tet (K) increased in last years (Lim et
This different mastitis percentage due to several al. 2012).
factors as the season of study, type of housing, breed, S. aureus has a high ability to get antibiotic
age of animals, type and severity of the causative agent resistance through rearrangement or mutation of the
and size of herd (Radostitis et al. 2007). genome, or by getting different antibiotic-resistance
It observed there clear differences in percentages of genes. It could acquire resistance to different antibiotics
isolates of S. aureus in samples of our study as horizontally (Inglis et al. 1988). The wide distribution of
compared with another study. The common causes are tet (K) and tet (L) among S. aureus strains depended on
the presence of antibacterial substances in the milk that several factors such as these genes are located on
leading to killing or a decrease in the bacteria in the milk mobile genetic elements such as small plasmids and
(Rainard and Riollet 2006, Taponen et al. 2009). conjugative transposons (Chopra and Roberts 2001)
Percentage of isolates of Staphylococcus aureus and that explain epidemiological varies.
that resisted for tetracycline depending on sensitivity test
was (57.1%). CONCLUSION
Tetracycline resistance isolates of staphalococcus
Tetracycline is antibiotic that has a wide range in
auirus were (56.7%), and that close to our results
treatment of the gram-negative and positive bacteria,
(Akanbi et al. 2017) while Nwankwo and Nasiru (2011)
therefore, it uses in different infections, the bacteria that
and Naimi et al. (2017) found a low rate of a tetracycline-
can resist tetracycline (tetracycline resistance isolates)
resistant isolate of S. auerus was 31.2% and 33%
causes diseases difficult in treatment and causes not a
respectively. Another study recorded high prevalence
response to all tetracycline.
REFERENCES
Ahmadi M, Rohani SMR, Ayremlou N (2010) Detection of Staphylococcus aureus in milk by PCR. Comparative
Clinical Pathology 19(1): 91-94.
Akanbi OE, Njom HA, Fri J, Otigbu AC, Clarke AM (2017) Antimicrobial Susceptibility of Staphylococcus aureus
Isolated from Recreational Waters and Beach Sand in Eastern Cape Province of South Africa. International
journal of environmental research and public health, 14(9): 1001.
1164EurAsian Journal of BioSciences 14: 1161-1166 (2020) Esmael and Majeed
Al- Anbagi NA, Kshash Q (2013) Daignosis of Staphylococcus aureus mastitis in bovine in Al-Najaf province by
using Polymerases chain reaction (PCR). AL-Qadisiya Journal of Vet. Med. Sci. 12(2).
Almobarak ME, Mohammed Salih RR and Gibreel HH (2020) In vitro efficacy of Tylosin and Enrofloxacin in treatment
of bovine mastitis causing bacteria in Omdurman locality. Online Journal of Animal and Feed Research, 10(2):
53-58. https://doi.org/10.36380/scil.2020.ojafr7
Andrés F, C‐A, Cervantes JL, Cantú‐Soto EU, Sánchez‐Machado DI, Campas‐Baypoli ON (2017) PCR Assay for
Detection of Staphylococcus aureus in Fresh Lettuce (Lactuca sativa), Intech. Open.
Arabzadeh F, Aeini F, Keshavarzi F, Karami P (2018) Resistance to Tetracycline and Vancomycin of Staphylococcus
aureus Isolates from Sanandaj Patients by Molecular Genotyping. Ann Clin Lab Res 6(4): 260.
Ardic N, Ozyurt M, Sareyyupoglu B (2005) Investigation of erythromycin and tetracycline resistance genes in
methicillin-resistant staphylococci. Int J Antimicrob Agents, 26: 213-218.
Bertrand X, Huguenin Y, Talon D (2002) First report of a catalase-negative methicillin-resistant Staphalococcus
aureus, Diagnostic Microbiology and Infectious Disease, 43(3): 245-246.
Bismuth R, Zilhao R, Sakamoto H, Guesdon JL, Courvalin P (1990) Gene heterogeneity for tetracycline resistance
in Staphylococcus spp. Antimicrob Agents Chemother 34(8): 1611-1614.
Boucher HW, Corey GR (2008) Epidemiology of methicillin-resistant Staphylococcus aureus. Clin Infect Dis, 46:
344-349.
Chopra I, Roberts M (2001) Tetracycline antibiotics: mode of action, applications, molecular biology, and
epidemiology of bacterial resistance. Microbiol Mol Biol Rev, 65(2): 232-260.
Chopra I, Roberts M (2001) Tetracycline antibiotics: mode of action, applications, molecular biology, and
epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65: 232-260.
Emaneini M, Bigverdi R, Kalantar D, Soroush S, Jabalameli F, Noorazar Khoshgnab B, Asadollahi P, Taherikalani
M (2013) Distribution of genes encoding tetracycline resistance and aminoglycoside modifying enzymes in
Staphylococcus aureus strains isolated from a burn center. Annals of burns and fire disasters, 26(2): 76-80.
Esposito S, Leone S, Petta E (2009) Treatment options for skin and soft tissue infections caused by meticillin-
resistant Staphylococcus aureus: oral vs. parenteral; home vs. hospital. Int J Antimicrob Agents, 34: 30-35.
Gitau W, Masika M, Musyoki M (2018) Antimicrobial susceptibility pattern of Staphylococcus aureus isolates from
clinical specimens at Kenyatta National Hospital. BMC Res Notes 11: 226.
Gordon RJ, Lowy FD (2008) Review Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin
Infect Dis. 1(46 Suppl 5): S350-9.
Hedayatianfard K, Akhlaghi M, Sharifiyazdi H (2014) Detection of tetracycline resistance genes in bacteria isolated
from fish farms using polymerase chain reaction. Veterinary research forum: an international quarterly journal,
5(4): 269-275.
Huys G, D’Haene K, Van Eldere J, von Holy A, Swings J (2005) Molecular diversity and characterization of
tetracycline-resistant Staphylococcus aureus isolate from a poultry processing plant. Appl Environ Microbiol
71(1): 574-579.
Inglis B, Matthews PR, Stewart PR (1988) The expression in Staphylococcus aureus of cloned DNA encoding
methicillin resistance. J Gen Microbiol 134(6): 1465-1469.
Jones CH, Tuckman M, Howe AY, Orlowski M, Mullen S, Chan K, Bradford PA (2006) Diagnostic PCR analysis of
the occurrence of methicillin and tetracycline resistance genes among Staphylococcus aureus isolates from
phase 3 clinical trials of tigecycline for complicated skin and skin structure infections. Antimicrob Agents
Chemother 50(2): 505-510.
Kareem SD, Olusegun AK, Samuel OO (2017) The Effect of Co2 Emission and Economic Growth on Energy
Consumption in Sub Sahara Africa. International Journal of Sustainable Energy and Environmental Research,
6(1): 27-35.
Li X, Huang T, Xu K (2019) Molecular characteristics and virulence gene profiles of Staphylococcus aureus isolates
in Hainan, China. BMC Infect Dis 19: 873.
Lim KT, Hanifah YA, Yusof M, Thong KL (2012) ermA, ermC, tetM and tetK are essential for erythromycin and
tetracycline resistance among methicillin resistant Staphylococcus aureus strains isolated from a tertiary hospital
in Malaysia. Indian J Med Microbiol 30(2): 203-207.
Mandell GL, Douglas RG, Bennet JE (2015) Principles and practice of infectious diseases.
McCallum N, Berger-Bachi B, Senn MM (2010) Regulation of antibiotic resistance in Staphylococcus aureus. Int J
Med Microbiol, 300: 118-129.
1165EurAsian Journal of BioSciences 14: 1161-1166 (2020) Esmael and Majeed
Naimi HM, Rasekh H, Noori AZ (2017) Determination of antimicrobial susceptibility patterns in Staphylococcus
aureus strains recovered from patients at two main health facilities in Kabul, Afghanistan. BMC Infect Dis 17:
737.
Nwankwo EO, Nasiru MS (2011) Antibiotic sensitivity pattern of Staphylococcus aureus from clinical isolates in a
tertiary health institution in Kano, Northwestern Nigeria. The Pan African medical journal, 8: 4.
Radostitis OM, Gay CC, Hinchliff KW (2007) Veterinary medicine a Texet book of the diseases of cattle, horses,
sheep, pigs and got 10 Edition London: W. Saunder Company Limited.
Rainard P, Riollet C (2006) Innate immunity of bovine mammary gland. Vet. Res., (37): 369-400.
Roberts MC (2005) Update on acquired tetracycline resistance genes. FEMS Microbiol Lett; 245(2): 195-203.
Robicsek A, Beaumont JL, Paule SM, Hacek DM, et al. (2008) Universal surveillance for methicillin-resistant
Staphylococcus aureus in 3 affiliated hospitals. Ann Intern Med. 18; 148(6): 409-418.
Rodriguez-Avial I, Rodriguez-Avial C, Culebras E, Picazo JJ (2003) Distribution of tetracycline resistance genes
tet(M), tet(O), tet(L) and tet(K) in blood isolates of viridans group streptococci harbouring erm(B) and mef(A)
genes. Susceptibility to quinupristin/dalfopristin and linezolid, International Journal of Antimicrobial Agents 21(6):
536-541.
Taponen S, Salmikivi L, Simojoki H, Koskinen MT, Pyörälä S (2009) Real-time polymerase chain reaction-based
identification of bacteria in milk samples from bovine clinical mastitis with no growth in conventional culturing in
milk. J. Dairy Sci., (92): 2610-2617.
Tripathi AB, Tancowny Q, Truong-Tran S, Retsema R, et al. (2006) Detection of Staphylococcus Aureus by Real-
Time PCR in Chronic Rhinosinusitis with Nasal Polyps. Journal of Allergy and Clinical Immunology, 117(2): S71.
Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG (2000) Expression of resistance to tetracyclines in strains of
methicillin-resistant Staphylococcus aureus. Journal of Antimicrobial Chemotherapy, 45(6): 763-770.
Velasco V, Sherwood JS, Rojas-García PP, Logue CM (2014) Multiplex Real-Time PCR for Detection of
Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from
Animals and Retail Meat. PLoS ONE 9(5): e97617.
www.ejobios.org
1166You can also read
