Resistance Elements in Enterococci Isolated in Scotland
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 2000, p. 2341–2348 Vol. 44, No. 9
0066-4804/00/$04.00⫹0
Copyright © 2000, American Society for Microbiology. All Rights Reserved.
Identification and Characterization of vanB2 Glycopeptide
Resistance Elements in Enterococci
Isolated in Scotland
K. F. MCGREGOR AND H.-K. YOUNG*
Department of Biological Sciences, University of Dundee, Dundee, United Kingdom
Received 6 March 2000/Returned for modification 4 May 2000/Accepted 14 June 2000
Thirty-two vanB glycopeptide-resistant enterococci (28 Enterococcus faecium and 4 Enterococcus faecalis) were
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
collected from hospitalized patients in Glasgow, Edinburgh, Dundee, and Aberdeen, Scotland, and the vanB
element in each was compared to vanB1 of E. faecalis strain ATCC 51299. HhaI digestion of PCR fragments of
the vanB ligase gene was used to identify vanB subtypes. All E. faecium isolates were vanB2, and all E. faecalis
isolates were vanB1. Restriction fragment length polymorphism analysis of a 5,180-bp vanSB-vanXB long-PCR
fragment of the vanB cluster showed the loss of HaeII restriction sites in vanSB, vanW, and vanXB in strains
containing a vanB2 ligase gene. Partial sequences of genes in the vanB2 cluster for two genomically distinct
Scottish isolates were >99.8% identical to each other. vanSB2, vanXB2, and vanB2 sequences differed at the
nucleotide level from those of vanSB, vanXB, and vanB by 4.2, 4.6, and 4.8%, respectively. The vanB2 resistance
element appears to be widespread among VanB glycopeptide-resistant E. faecium strains isolated in Scottish
hospitals.
Glycopeptide-resistant enterococci (GRE) are increasingly DNA fragments (6, 21, 22), and two distinct vanB-containing
being reported (15), causing great concern in the hospital en- transposons have been described, Tn1547 (22) and Tn5382 (6).
vironment. Acquired glycopeptide resistance is mediated by a The seven genes of the vanB cluster appear to be conserved
complex, well-controlled cluster of genes, of which vanA and within the strains studied to date, and unlike vanA clusters, an
vanB are the most common. Both the vanA and vanB resis- IS element has been detected within the cluster in only a single
tance clusters comprise seven genes: vanR, vanS, vanH, vanA, isolate (7). However, while the vanB gene clusters appear to be
vanX, vanY, and vanZ and vanRB, vanSB, vanYB, vanW, vanHB, structurally conserved, heterogeneity at the nucleotide level
vanB, and vanXB, respectively (2). has been reported. Based on sequence variability in the vanB
The vanA gene cluster appears to be universally carried on ligase gene, three subtypes have been described, termed
transposon Tn1546 or similarly organized elements, often con- vanB1, vanB2, and vanB3 (7, 11, 19). Furthermore, Dahl et al.
taining additional insertion sequence (IS) elements (1, 13, 14, (7) showed that the sequence of the vanSB-vanYB intergenic
18, 26). Similarly, the vanB gene cluster is believed to be part region varied among vanB1, vanB2, and vanB3 isolates.
of a larger element. Conjugative transfer of chromosomal vanB This paper describes a PCR-based approach to identify the
resistance is associated with the movement of 90- to 250-kb vanB subtype and to assess variation in the elements mediating
FIG. 1. Schematic representation of vanB gene cluster of strain V583. PCR fragments generated from primers used in this study and the restriction profile of an
L-PCR fragment are shown. ⴱ, HaeII sites that are not present in vanB2 strains. Sizes are given in base pairs.
* Corresponding author. Mailing address: Department of Biological
Sciences, University of Dundee, Dundee DD1 4HN, United Kingdom.
Phone: 44-1382-344270. Fax: 44-1382-344275. E-mail: h.k.young@dundee
.ac.uk.
23412342 MCGREGOR AND YOUNG ANTIMICROB. AGENTS CHEMOTHER.
TABLE 1. Characteristics of vanB GRE isolates
MIC (g/ml) of: Susceptibilityc PFGE vanB L-PCR-HaeII
Straina Species
VAN g
TEC AMP TET STR GEN CIP type subtypef profile
G-003 E. faecium 32 0.5 R R R R S A1 vanB2 RFLP-2
G-097 E. faecium 16 ⬍0.25 R R R R S A1 vanB2 RFLP-2
G-105 E. faecium 32 0.5 R R R R S A1 vanB2 RFLP-2
G-112 E. faecium 8 0.25 R R R R S A1 vanB2 RFLP-2
G-031 E. faecium 16 0.5 R R HLR R S A1e vanB2 RFLP-2
G-076 E. faecium 16 0.25 R S R R S A1e vanB2 RFLP-2
G-060 E. faecium 8 ⬍0.25 R R R R S A2 vanB2 RFLP-2
G-153 E. faecium 8 ⬍0.25 S R R R S A2e vanB2 RFLP-2
G-138 E. faecium 16 ⬍0.25 R R R R S A4 vanB2 RFLP-2
G-142 E. faecium 16 0.5 R R R HLR S A5 vanB2 RFLP-2
G-144 E. faecium 16 0.5 R R R R S A11 vanB2 RFLP-2
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
G-015 E. faecium 8 0.5 R R R R S B4 vanB2 RFLP-2
G-051 E. faecium 128 0.5 R R R R S C1 vanB2 RFLP-2
G-009 E. faecium 32 0.5 R R HLR R S D1 vanB2 RFLP-2
G-013 E. faecium 8 ⬍0.25 S S R R S E1 vanB2 RFLP-2
G-014 E. faecium 8 0.5 R R HLR R S F1 vanB2 RFLP-2
G-102 E. faecium 8 1 R R HLR R S G1 vanB2 RFLP-2
G-116b E. faecium 256 32 R S R HLR R H1 vanB2 RFLP-2
G-075 E. faecium 8 ⬍0.25 R S R R R V1 vanB2 RFLP-2
G-139 E. faecium 16 ⬍0.25 R S R R R W1 vanB2 RFLP-2
D-002 E. faecium 8 0.5 R S R R S J1 vanB2 RFLP-2
D-003 E. faecium 8 1 S S R R S J1e vanB2 RFLP-2
D-009 E. faecium 16 0.5 R R HLR R R K1 vanB2 RFLP-2
D-004 E. faecium 16 0.5 R R R R R M1 vanB2 RFLP-2
D-005 E. faecium 16 0.5 R R R R R M1 vanB2 RFLP-2
A-004 E. faecium 16 0.5 R R HLR R S P1 vanB2 RFLP-2
E-031 E. faecium 32 0.5 R S HLR R S N1 vanB2 RFLP-2
E-015 E. faecium 16 0.5 R R HLR R R S1 vanB2 RFLP-2
E-023 E. faecalis 32 0.25 S S R HLR S R1 vanB1 RFLP-1
E-024 E. faecalis 32 0.25 S S HLR R S T1 vanB1 RFLP-1
E-018 E. faecalis 32 0.5 S S HLR HLR S L1 vanB1 RFLP-1
E-022 E. faecalis 16 0.25 S S HLR HLR S L1 vanB1 RFLP-1
ATCC 51299 E. faecalis 16 0.5 S S Rd HLR S L1e vanB1 RFLP-1
a
Scottish isolates have been given prefixes to indicate their origins: G, Glasgow; D, Dundee; E, Edinburgh; and A, Aberdeen. ATCC 51299 was isolated in the United
States (24).
b
Carries both vanA and vanB resistance elements (17).
c
R, resistant; S, susceptible; HLR, high-level resistance. The breakpoints are those in Nelson et al. (17).
d
Reported by Swenson et al. (24) to have high-level streptomycin resistance.
e
Strain with the same PFGE pattern as another isolate(s) but a different level of susceptibility to ampicillin, tetracycline, or streptomycin.
f
Determined by HhaI restriction pattern and sequence analysis of B1-B2 vanB PCR fragments.
g
VAN, vancomycin; TEC, teicoplanin; AMP, ampicillin; TET, tetracycline; STR, streptomycin; GEN, gentamicin; CIP, ciprofloxacin.
vanB-type glycopeptide resistance in enterococci isolated in band differences were regarded as related, and those with seven or more band
Scotland. differences were regarded as unrelated.
Preparation of genomic DNA. Genomic DNA for use as a template in PCRs
was isolated by the cetyltrimethylammonium bromide extraction method of Wil-
MATERIALS AND METHODS son (27) as modified by Handwerger et al. (13).
Bacterial strains. A total of 33 isolates were collected for this study (Table 1).
Of these, 32 were isolated between 1995 and 1998 from hospitalized patients in
Scotland, including 20 in Glasgow (17), 6 in Edinburgh (5), 5 in Dundee, and 1
in Aberdeen. The 20 Glasgow isolates were selected from a collection of 138 TABLE 2. Primers used for the amplification of fragments of the
vanB Enterococcus faecium isolates (17), based on varied levels of resistance to
vancomycin, ampicillin, tetracycline, streptomycin, gentamicin, and ciprofloxacin,
vanB gene cluster
and included 4 clinical and 16 fecal-screen strains isolated over a 30-month Primer 5⬘-3⬘ sequence Positionc
period in three different hospitals. Enterococcus faecalis isolate ATCC 51299
from the United States was also included (24). R1 GATGATCATATCTGCAATACAGTAAG 208–233
The isolates were identified to the species level by PCR amplification of
S1a AAATCGCAAGGGAACATG 1476–1493
intergenic rRNA spacer regions and biochemistry as described previously (17).
All of the isolates showed resistance to vancomycin (MIC ⬎ 8 g/ml) while S2 ACGCCCATGTTCAAAACG 1960–1978
remaining susceptible to teicoplanin (MIC ⬍ 2 g/ml), in accordance with the B1b ATGGGAAGCCGATAGTC 5143–5160
VanB phenotype, and produced a 635-bp product in amplification reactions with B2b GATTTCGTTCCTCGACC 5762–5778
primers B1 and B2, indicative of the presence of the vanB ligase gene (8). X1 TTGCATGGTGTTCGTTGG 6037–6055
Ampicillin, tetracycline, streptomycin, gentamicin, and ciprofloxacin susceptibil- X2a CGGGGTATGGCTCATCAA 6567–6584
ity testing was performed, and the isolates were defined as susceptible or resis-
a
tant as described previously (17). Primer used for L-PCR.
b
PFGE typing. All isolates were assigned a pulsed-field gel electrophoresis Primer to amplify vanB ligase gene (8).
c
(PFGE) type based on restriction fragment length polymorphism (RFLP) pat- In sequence of vanB gene cluster of strain V583 (GenBank accession number
terns of SmaI-digested DNA as described previously (17). Strains with one to six U35369).Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
FIG. 2. Comparison of DNA sequences of vanB genes from GRE isolates to positions 5144 to 5778 of the vanB1 sequence of strain V583. Strains 86 and 45 are
vanB2 and vanB3, respectively (19). Primers B1 and B2 are shown in boldface. HhaI restriction sites are underlined. The dashes indicate identical sequence.
23432344 MCGREGOR AND YOUNG ANTIMICROB. AGENTS CHEMOTHER.
Identification of vanB subtype. The vanB ligase gene of each
isolate was amplified using the primers B1 and B2. All gave a
635-bp product. Analysis of vanB1, vanB2, and vanB3 ligase
gene sequences in the GenBank database suggested the differ-
ent subtypes could be partially distinguished by RFLP analysis
of the vanB PCR product. An A 3 G nucleotide substitution
at position 5454 would result in the creation of an HhaI site in
vanB2 isolates, while a C 3 T substitution at position 5618
would result in the loss of an HhaI site in vanB2 isolates (Fig.
2). Thus, HhaI digestion of the 635-bp B1-B2 vanB PCR frag-
ment would give bands of 479 and 159 bp for vanB1 and vanB3
and bands of 313 and 322 bp for vanB2. By vanB-HhaI analysis,
FIG. 3. HhaI digestion of 635-bp B1-B2 vanB PCR fragments. Lanes: 1, strain ATCC 51299 and the four E. faecalis isolates from Ed-
G-142; 2, D-002; 3, A-004; 4, E-015; 5, E-023; 6, ATCC 51299; 7, 100-bp DNA inburgh gave vanB1 or vanB3 patterns while all E. faecium
ladder (Promega). The image was generated with Adobe Photoshop 4.0.
isolates were vanB2 (Fig. 3; the 313- and 322-bp bands appear
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
as a single band).
The B1-B2 vanB PCR fragments from the five non-vanB2
PCR amplification of van genes. A fragment of the vanB ligase gene was strains (ATCC 51299, E-018, E-022, E-023, and E-024) and
amplified using primers B1 and B2 described by Dutka-Malen et al. (8). Primers two vanB2 isolates (G-142 and D-002) were sequenced. Over
were designed to amplify fragments of the vanSB and vanXB genes and regions 591 bp, strain ATCC 51299 was identical to vanB1 strain V583
between genes (Fig. 1) from the sequence of the vanB gene cluster of the E.
faecalis vanB1 strain V583 and are listed in Table 2. (Fig. 2). The four non-vanB2 isolates from Edinburgh likewise
Fragments smaller than 2 kb were amplified from approximately 100 ng of had sequences identical to that of V583 (data not shown),
template DNA. The reaction mixtures and amplification conditions were as indicating that all were vanB1. The vanB sequences of strains
described previously (17). G-142 and D-002 showed 27 (4.6%) nucleotide differences
L-PCR. Fragments (5,108 bp) of vanSB-vanXB were amplified from approxi-
mately 500 ng of template DNA with primers S1 and X2 using the Expand from strain V583. The G-142 and D-002 sequences were iden-
long-template PCR (L-PCR) system (Boehringer, Mannheim, Germany). The tical to that of vanB2 strain 86 (19), verifying the presence of
reaction mixtures were prepared in buffer 1 in accordance with the manufactur- the vanB2 subtype as determined by vanB-HhaI profiles.
er’s specifications. The amplification conditions were 94°C for 2 min; 10 cycles of
94°C for 10 s, 58°C for 30 s, and 68°C for 5 min; 20 cycles of 94°C for 10 s, 58°C
for 30 s, and 68°C for 5 min with the elongation time increased by 20 s each cycle;
and one cycle of 68°C for 7 min.
RFLP analysis. All restriction enzymes were supplied by Promega (Madison,
Wis.), except BspHI (New England Biolabs, Hitchin, United Kingdom), and were
used in accordance with the manufacturer’s specifications.
Sequencing. Cycle sequencing of PCR fragments was carried out according to
the manufacturer’s instructions using the DYEnamic ET terminator cycle-se-
quencing premix kit (Amersham, Little Chalfont, United Kingdom). The ABI
373 DNA-sequencing system was used to sequence each template from one
strand only.
Nucleotide sequence accession numbers. The sequences generated in this
study have been entered into the EMBL database. The accession numbers are
AJ272437 (E. faecium D-002 vanSB) and AJ272436 (E. faecium D-002 vanXB).
All sequences were aligned with that of E. faecalis strain V583 (9), GenBank
accession number U35369. All position numbers given refer to this sequence.
RESULTS
In this study, the elements mediating VanB glycopeptide
resistance in 32 enterococci isolated from Scottish hospitals
were analyzed and compared to strain ATCC 51299 (24) and
the vanB gene cluster of strain V583 (9), both from the United
States.
Twenty-eight (88%) of the 32 Scottish isolates were identi-
fied as E. faecium; the remaining four (all isolates from Edin-
burgh) were identified as E. faecalis. Nineteen (59%) of 32
were distinct by PFGE typing. Ten of the Glasgow isolates
were identical or related to the A1 type. Some of the isolates
with the same PFGE type differed in their levels of suscepti-
bility to ampicillin, tetracycline, or streptomycin (Table 1).
These related isolates were included in the study, as previous
workers have noted that different vanA elements may be car-
ried in enterococci with the same PFGE pattern (12, 25) and
we were interested in determining if similar phenomena may
occur in vanB isolates. Furthermore, a single strain of entero-
cocci can lose and acquire different van resistance elements FIG. 4. PCR fragments and RFLP profiles of representative vanB1 and
over time (23, 29). The observation that two of the four Scot- vanB2 isolates. The image was generated with Adobe Photoshop 4.0. (A) S1-X2
vanSB-vanXB L-PCR fragments and resulting RFLP profiles. Lanes: 1, GeneR-
tish E. faecalis isolates had SmaI patterns (PFGE type L1) uler 1-kb DNA ladder (MBI Fermentas); 2, ATCC 51299; 3, D-002; 4, G-142. (B)
identical to that of E. faecalis strain ATCC 52199 was of in- BspHI digestion of 1,771-bp R1-S2 vanRB-vanSB PCR fragments. Lanes: 1,
terest. GeneRuler 1-kb DNA ladder; 2, E-023; 3, ATCC 51299; 4, G142; 5, D-002.VOL. 44, 2000 CHARACTERIZATION OF vanB ELEMENTS 2345
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
FIG. 5. Comparison of DNA sequences of vanSB genes from GRE isolates to positions 1495 to 1924 of the vanSB sequence of strain V583. The HaeII restriction
site is underlined. The dashes indicate identical sequence.
Characterization of vanB resistance elements. To further differed. In these isolates, HaeII digestion gave two bands
characterize the glycopeptide resistance elements in our iso- instead of five (RFLP-2 [Table 1]), suggesting the loss of three
lates, L-PCR and PCR mapping were used. Primers R1 and S2 HaeII sites (Fig. 4A). DraI/HaeII double digests indicated
were used to amplify vanRB-vanSB, and L-PCR was used to HaeII sites were lost in vanSB, vanW, and vanXB (data not
amplify a 5,108-bp fragment of vanSB-vanXB. L-PCR products shown).
were digested with EcoRV, BspHI, and DraI. Additionally, Dahl et al. (7) described two RFLP patterns based on BspHI
amplified fragments were digested with HaeII, as analysis of digestion of vanRB-vanXB L-PCR fragments. Strains with the
the vanB3 sequence suggested that vanB3 isolates would have vanB2 gene all had an additional BspHI site in vanRB-vanSB.
an additional HaeII site within the vanB ligase gene (down- To determine if our vanB2 strains had the same additional
stream of primer B2).
BspHI site, R1-S2 PCR fragments were digested with this en-
ATCC 51299 and the four E. faecalis isolates gave bands
zyme. All vanB2 isolates had this additional site, and the sizes
expected for vanB1 strain V583 when digested with EcoRV,
BspHI, and DraI (Fig. 4A). Digestion with HaeII gave the five of the bands suggested the additional site was within the vanSB
bands expected for strain V583 (Fig. 1), confirming the pres- gene (Fig. 4B).
ence of a vanB1 ligase gene, not vanB3 (the five-band pattern Sequencing of vanSB and vanXB genes. L-PCR-HaeII profiles
is referred to as RFLP-1 [Table 1]). revealed the loss of HaeII sites in the vanSB and vanXB genes.
All E. faecium isolates were identical to V583 by EcoRV, To further characterize the alterations in these genes, primers
BspHI, and DraI digestion, but their HaeII digestion patterns were designed to amplify fragments of the two genes (Table 22346 MCGREGOR AND YOUNG ANTIMICROB. AGENTS CHEMOTHER.
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
FIG. 6. Comparison of DNA sequences of vanXB genes from GRE isolates to positions 6091 to 6566 of the vanXB sequence of strain V583. The HaeII restriction
site is underlined. The dashes indicate identical sequence.
and Fig. 1). Sequence was generated from S1-S2 and X1-X2 nucleotide changes: C 3 G at position 6179 and G 3 C at
fragments of ATCC 51299, G-142, and D-002. position 6180 (Fig. 6). D-002 differed from V583 by 22 nucle-
Over 430 bp of the S1-S2 PCR fragment, ATCC 51299 was otides (4.8%) (including the two differences seen in ATCC
identical to V583 (Fig. 5). D-002 was identical to G-142 and 51299) and 7 amino acids in 158 (4.4%). G-142 was identical to
showed 18 nucleotide changes (4.2%) and 4 amino acid D-002 except for a unique nucleotide change, C 3 G at posi-
changes in 142 (2.8%) compared to strain V583. The substitu- tion 6271, which resulted in an additional amino acid change.
tion G 3 A at position 1865 resulted in the loss of an HaeII The C 3 T substitution at position 6146 in G-142 and D-002
site. The vanSB gene of the vanB2 gene cluster has been resulted in the loss of an HaeII site. The vanXB gene of the
termed vanSB2. vanB2 gene cluster has been termed vanXB2.
Additionally, S1-S2 PCR fragments from the remaining 30
Two other sequences available in GenBank give partial se-
strains were digested with AluI and Sau3AI (not shown), both
quences of the vanXB gene. Alignment of these sequences with
of which give different bands for vanSB and vanSB2 fragments.
The resulting RFLP profiles suggested that all vanB1 isolates ours shows the same differences as in G-142 and D-002 (Fig.
were identical to V583 at these sites and all vanB2 isolates had 6). Strain C68 (a U.S. isolate in which the vanB gene cluster is
the same nucleotide sequence changes at these sites as G-142 contained within Tn5382 [6]) shows five nucleotide differences
and D-002. from V583 in a 196-bp overlap. Strain TSGH1 from Taiwan
Likewise, X1-X2 vanXB PCR fragments were sequenced. (GenBank accession no. U81452) shows two nucleotide differ-
Over 476 bp, ATCC 51299 was identical to V583 except for two ences in 64 bp.VOL. 44, 2000 CHARACTERIZATION OF vanB ELEMENTS 2347
DISCUSSION no. U81452), and the vanSB-vanYB intergenic region (7), sug-
gests all genes in the vanB2 cluster may differ from those in the
VanB GRE have been reported as an important cause of vanB1 cluster.
infection in a number of hospitals in the United States (4, 16, vanB has been shown to be associated with the transfer of
20) and recently in a Scottish hospital (17). While the struc- different-size fragments of DNA (ranging from 90 to 250 kb),
tural diversity within vanA glycopeptide resistance elements which suggests the gene cluster may be contained within dif-
has been the subject of numerous studies, there have been ferent structures. A number of potential elements have been
relatively few studies of the vanB elements, and most have described. A 64-kb composite transposon (Tn1547), bounded
focused on the vanB ligase gene. A study by Dahl et al. (7) has by IS256-like and IS16 elements, has been identified in the
examined the vanB gene cluster from vanRB-vanXB, showing transposition of vanB from chromosome to plasmid DNA (22),
the element to be structurally identical in 16 of 17 isolates but although this element was not involved in conjugative chromo-
with nucleotide heterogeneity in the vanSB-vanYB intergenic some-to-chromosome transfer. A 55-MDa transferable plas-
region and the vanB gene. In this study we report the devel- mid containing both vanB and aac6⬘aph2⬙ gentamicin resis-
opment of PCR mapping techniques and RFLP analysis to tance genes has been reported (28). vanB has been associated
examine diversity in vanB elements. with a 27-kb conjugative transposon (Tn5382) which may be
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
The PCR RFLP (vanB-HhaI) method proved useful for the part of a 160-kb element containing both vanB and high-level
identification of vanB subtypes, particularly vanB2. The vanB1 ampicillin resistance genes (6). It would be of interest to know
and vanB3 subtypes could not be distinguished by this method. if the different vanB subtypes are associated with different
Primers could be designed to allow amplification of a larger elements. Partial sequence of the vanXB gene of E. faecium
fragment of the vanB ligase gene that would include the addi- strain C68 (a U.S. isolate which harbors Tn5382) (6) suggests
tional HaeII site within the vanB3 gene. HhaI/HaeII double this strain carries a vanB2 element. Future studies will examine
digests of such a vanB fragment would allow the distinction of whether Tn5382 is present in Scottish vanB2 isolates.
vanB1, vanB2, and vanB3 genes. However, at present sequence This study describes new techniques for the identification
analysis of the vanB gene of potential vanB1 and vanB3 isolates and characterization of vanB glycopeptide resistance elements.
is recommended. When more studies have been done with a Previous observations of sequence variability in the gene clus-
larger number of vanB strains, preferably including L-PCR ter have been confirmed and extended.
analysis, the true extent of variation within the vanB subtypes
may be better understood, allowing the development of meth- ACKNOWLEDGMENTS
ods to distinguish all subtypes.
Dahl et al. (7) suggest caution when choosing primers for This study was supported by the Scottish Office Department of
Health, grant reference number K/MRS/50/C2607.
vanB ligase amplification (which is the main molecular method
We thank R. Nelson of the Western Infirmary, Glasgow, United
of genotypic determination of van type in the laboratory). We Kingdom; A. Brown of Edinburgh University, Edinburgh, United
found the B1-B2 primers of Dutka-Malen et al. (8) suitable for Kingdom; G. Phillips of Ninewells Hospital, Dundee, United King-
amplification of both vanB1 and vanB2 genes despite one mis- dom; and T. Reid of Aberdeen Royal Infirmary, Aberdeen, United
match in primer B1 in the vanB2 gene and two in B2 (Fig. 2). Kingdom for providing strains.
As we do not have any vanB3 isolates, we do not know if these
primers would be suitable for the amplification of vanB3 frag- REFERENCES
ments. The vanB3 sequence is identical to vanB2 for B1 but 1. Arthur, M., C. Molinas, F. Depardieu, and P. Courvalin. 1993. Character-
contains an additional mismatch at the 3⬘ end of B2. GRE with ization of Tn1546, a Tn3-related transposon conferring glycopeptide resis-
tance by synthesis of depsipeptide peptidoglycan precursors in Enterococcus
a VanB phenotype that did not produce an amplification prod- faecium BM4147. J. Bacteriol. 175:117–127.
uct with vanB primers have been reported (3). This suggests 2. Arthur, M., P. Reynolds, and P. Courvalin. 1996. Glycopeptide resistance in
the primers may not have been suitable for the amplification of enterococci. Trends Microbiol. 4:401–407.
all vanB subtypes or that other, as yet undetected subtypes of 3. Bell, J. M., J. C. Paton, and J. Turnidge. 1998. Emergence of vancomycin-
resistant enterococci in Australia: phenotypic and genotypic characteristics
vanB exist. Alternatively, there may be different gene clusters of isolates. J. Clin. Microbiol. 36:2187–2190.
that give a VanB phenotype, for example, the newly identified 4. Boyce, J. M., S. M. Opal, J. W. Chow, M. J. Zervos, G. Potterbynoe, C. B.
vanE element (10). Sherman, R. L. C. Romulo, S. Fortna, and A. A. Medeiros. 1994. Outbreak
In this study, vanB2 was associated with E. faecium and of multidrug-resistant Enterococcus faecium with transferable vanB class
vancomycin resistance. J. Clin. Microbiol. 32:1148–1153.
vanB1 was associated with E. faecalis, although work by other 5. Brown, A. R., S. G. B. Amyes, R. Paton, W. D. Plant, G. M. Stevenson, R. J.
investigators (7, 11, 19) suggests the resistance elements are Winney, and R. S. Miles. 1998. Epidemiology and control of vancomycin-
not species specific. No other vanB subtypes were identified in resistant enterococci (VRE) in a renal unit. J. Hosp. Infect. 40:115–124.
this study. vanB2 elements have now been detected worldwide, 6. Carias, L. L., S. D. Rudin, C. J. Donskey, and L. B. Rice. 1998. Genetic
linkage and cotransfer of a novel, vanB-containing transposon (Tn5382) and
including the United States, Europe, and Taiwan (6, 11, 19; a low-affinity penicillin-binding protein 5 gene in a clinical vancomycin-
GenBank accession no. U81452). To date, vanB3 has been resistant Enterococcus faecium isolate. J. Bacteriol. 180:4426–4434.
detected only in a single U.S. isolate (19). 7. Dahl, K. H., G. S. Simonsen, O. Olsvik, and A. Sundsfjord. 1999. Hetero-
The majority of European vanB enterococci appear to carry geneity in the vanB gene cluster of genomically diverse clinical strains of
vancomycin-resistant enterococci. Antimicrob. Agents Chemother. 43:1105–
the vanB2 element. Dahl et al. (7) found a vanB2 element in 1110.
seven (88%) of eight European isolates, including strains from 8. Dutka-Malen, S., S. Evers, and P. Courvalin. 1995. Detection of glycopep-
Sweden, Norway, Germany, and the United Kingdom, com- tide resistance genotypes and identification to the species level of clinically
pared to only two (22%) of nine U.S. isolates. Likewise, vanB2 relevant enterococci by PCR. J. Clin. Microbiol. 33:24–27.
9. Evers, S., and P. Courvalin. 1996. Regulation of vanB-type vancomycin
was detected in 88% of Scottish vanB enterococci in this study. resistance gene expression by the vanSB-vanRB two-component regulatory
vanB2 also appears to be the major type in Finland (23). system in Enterococcus faecalis V583. J. Bacteriol. 178:1302–1309.
We have shown that vanB2 glycopeptide resistance elements 10. Fines, M., B. Perichon, P. Reynolds, D. F. Sahm, and P. Courvalin. 1999.
differ from vanB1 elements by nucleotide heterogeneity in the VanE, a new type of acquired glycopeptide resistance in Enterococcus fae-
calis BM4405. Antimicrob. Agents Chemother. 43:2161–2164.
vanSB and vanXB genes. The loss of a HaeII restriction site in 11. Gold, H. S., S. Unal, E. Cercenado, C. Thauvin-Eliopoulos, G. M. Eliopou-
vanW shown in this study, together with previous reports of los, C. B. Wennersten, and R. C. Moellering. 1993. A gene conferring
heterogeneity in vanB (7, 11, 19), vanHB (GenBank accession resistance to vancomycin but not teicoplanin in isolates of Enterococcus2348 MCGREGOR AND YOUNG ANTIMICROB. AGENTS CHEMOTHER.
faecalis and Enterococcus faecium demonstrates homology with vanB, vanA, resistance determinant vanB between enterococci involves the movement of
and vanC genes of enterococci. Antimicrob. Agents Chemother. 37:1604– large genetic elements from chromosome to chromosome. FEMS Microbiol.
1609. Lett. 119:359–363.
12. Goossens, H., P. Descheemaeker, S. Chapelle, M. Leven, P. Vandamme, and 22. Quintiliani, R., and P. Courvalin. 1996. Characterization of Tn1547, a com-
L. A. Devriese. 1999. Comparison of human and animal vanA Enterococcus posite transposon flanked by the IS16 and IS256-like elements, that confers
faecium in Belgium. Clin. Microbiol. Infect. 5(Suppl. 3):122. (Abstract P141.) vancomycin resistance in Enterococcus faecalis BM4281. Gene 172:1–8.
13. Handwerger, S., J. Skoble, L. F. Discotto, and M. J. Pucci. 1995. Heteroge- 23. Suppola, J. P., E. Kolho, S. Salmenlinna, E. Tarkka, and V. Varkila. 1999.
neity of the vanA gene cluster in clinical isolates of enterococci from the vanA and vanB incorporate into an endemic ampicillin-resistant vancomycin-
northeastern United States. Antimicrob. Agents Chemother. 39:362–368. sensitive Enterococcus faecium strain: effect on interpretation of clonality.
14. Jensen, L. B., P. Ahrens, L. Dons, R. N. Jones, A. M. Hammerum, and F. M. J. Clin. Microbiol. 37:3934–3939.
Aarestrup. 1998. Molecular analysis of Tn1546 in Enterococcus faecium iso- 24. Swenson, J. M., N. C. Clark, D. F. Sahm, M. L. Ferraro, G. Doern, J.
lated from animals and humans. J. Clin. Microbiol. 36:437–442. Hindler, J. H. Jorgensen, M. A. Pfaller, L. B. Reller, M. P. Weinstein, R. J.
15. McDonald, L. C., and W. R. Jarvis. 1997. The global impact of vancomycin- Zabransky, and F. C. Tenover. 1995. Molecular characterization and multi-
resistant enterococci. Curr. Opin. Infect. Dis. 10:304–309. laboratory evaluation of Enterococcus faecalis ATCC 51299 for quality-con-
16. Moreno, F., P. Grota, C. Crisp, K. Magnon, G. P. Melcher, J. H. Jorgensen, trol of screening tests for vancomycin and high-level aminoglycoside resis-
and J. E. Patterson. 1995. Clinical and molecular epidemiology of vancomy- tance in enterococci. J. Clin. Microbiol. 33:3019–3021.
cin-resistant Enterococcus faecium during its emergence in a city in Southern 25. Tremlett, C. H., D. F. J. Brown, and N. Woodford. 1999. Variation in
Texas. Clin. Infect. Dis. 21:1234–1237. structure and location of VanA glycopeptide resistance elements among
Downloaded from http://aac.asm.org/ on February 12, 2021 by guest
17. Nelson, R. R. S., K. F. McGregor, A. R. Brown, S. G. B. Amyes, and H.-K. enterococci from a single patient. J. Clin. Microbiol. 37:818–820.
Young. 2000. Isolation and characterization of glycopeptide-resistant entero- 26. Willems, R. J. L., J. Top, N. vandenBraak, A. vanBelkum, D. J. Mevius, G.
cocci from hospitalized patients over a 30-month period. J. Clin. Microbiol. Hendriks, M. vanSanten Verheuvel, and J. D. A. vanEmbden. 1999. Molec-
38:2112–2116. ular diversity and evolutionary relationships of Tn1546-like elements in en-
18. Palepou, M. F. I., A. M. A. Adebiyi, C. H. Tremlett, L. B. Jensen, and N. terococci from humans and animals. Antimicrob. Agents Chemother. 43:
Woodford. 1998. Molecular analysis of diverse elements mediating VanA 483–491.
glycopeptide resistance in enterococci. J. Antimicrob. Chemother. 42:605– 27. Wilson, K. 1994. Preparation of genomic DNA from bacteria, p. 2.4.1–2.4.2.
612. In F. M. Ausubel (ed.), Current protocols in molecular biology. Greene
19. Patel, R., J. R. Uhl, P. Kohner, M. K. Hopkins, J. M. Steckelberg, B. Kline, Publishing Associates, Brooklyn, N.Y.
and F. R. Cockerill. 1998. DNA sequence variation within vanA, vanB, 28. Woodford, N., B. L. Jones, Z. Baccus, H. A. Ludlam, and D. F. J. Brown.
vanC-1, and vanC-2/3 genes of clinical enterococcus isolates. Antimicrob. 1995. Linkage of vancomycin and high-level gentamicin resistance genes on
Agents Chemother. 42:202–205. the same plasmid in a clinical isolate of Enterococcus faecalis. J. Antimicrob.
20. Perlada, D. E., A. G. Smulian, and M. T. Cushion. 1997. Molecular epide- Chemother. 35:179–184.
miology and antibiotic susceptibility of enterococci in Cincinnati, Ohio: a 29. Woodford, N., P. R. Chadwick, D. Morrison, and B. D. Cookson. 1997.
prospective citywide survey. J. Clin. Microbiol. 35:2342–2347. Strains of glycopeptide-resistant Enterococcus faecium can alter their van
21. Quintiliani, R., and P. Courvalin. 1994. Conjugal transfer of the vancomycin genotypes during an outbreak. J. Clin. Microbiol. 35:2966–2968.You can also read
