Molecular detection of Bartonella henselae in 11 Ixodes ricinus ticks extracted from a single cat - BioMed Central
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Regier et al. Parasites & Vectors (2017) 10:105
DOI 10.1186/s13071-017-2042-7
SHORT REPORT Open Access
Molecular detection of Bartonella henselae
in 11 Ixodes ricinus ticks extracted from a
single cat
Yvonne Regier, Wibke Ballhorn and Volkhard A. J. Kempf*
Abstract
Background: Bartonella henselae is a highly prevalent, vector-borne pathogen. Transmission to humans and animals
by ticks is discussed controversially. Here, we present a case report, where eleven Ixodes ricinus ticks all harbouring
B. henselae DNA were removed from one single cat.
Results: The first feeding tick was tested positive for B. henselae DNA. The cat was also found to be seropositive for
anti-B. henselae IgG antibodies (titer 1:640). Bartonella henselae was not cultivatable from cat blood. Ten more
feeding ticks removed 7 months later contained also B. henselae DNA. Sequence analysis of the 16SrDNA and the 16S-23S
internal transcribed spacer (ITS) region revealed 100% sequence homology between all ticks. Bartonella adhesin A (badA)
and VirB/VirD4 type IV secretion system (virB) DNA were also detected in all ticks.
Conclusions: Our results indicate that cats may serve as a reservoir for adult ticks to acquire B. henselae. Whether
this observation implies an increased threat for human and animal health needs to be resolved.
Keywords: Vector-borne infections, Transmission, Zoonosis, BadA, VirB, Feline bartonellosis
Background has not been experimentally proven in vivo, an in vitro
Bartonella henselae is a Gram-negative, facultative intra- model employing an artificial feeding system successfully
cellular, zoonotic pathogen [1]. In its reservoir host “cat” B. demonstrated transmission of B. henselae by ticks [14].
henselae causes a long lasting, intraerythrocytic, clinically Furthermore, in a mouse infection model, the vector
asymptomatic bacteremia [2, 3]. However, cats may also competence of ticks has been demonstrated for the
develop diseases like endocarditis [4] and febrile illness [5]. murine pathogen Bartonella birtlesii [15]. However,
Prevalence of anti-Bartonella antibodies in cat populations discussions about the role of ticks as vectors for B.
ranges from 0% in Norway [6] to 71% in Spain [7]. Im- henselae are ongoing [16]. This case report describes
munocompetent humans can be infected with B. henselae the detection of B. henselae DNA in 11 ticks removed
by cat scratches or bites and may suffer thereafter from from one cat with an anti-B. henselae IgG titer of 1:640.
cat scratch disease [1], whereas immunocompromised
individuals may develop vasoproliferative diseases (bacillary Methods
angiomatosis, peliosis hepatis [8, 9]). Among cats, B. Sample drawing
henselae is transmitted via cat fleas by contamination Feeding ticks were removed from a 7-year-old, male,
of wounds with infected flea feces [10]. Other ectoparasites, roaming Norwegian forest cat from Rastatt, Germany
e.g. ticks, are also suspect vectors for B. henselae [11]. (48°51′N, 8°12′E) and stored at -20 °C in separate tubes
Prevalence of B. henselae DNA in Ixodes ricinus varies from containing ethanol. As the cat is a roaming cat with
0% in Finland [12] to 60% in the Netherlands [13]. access to a rural area, tick contact occurs frequently.
Although vector competence of ticks for B. henselae The first tick was removed in November 2015 and 10
more ticks were taken between March and June 2016
whenever a tick was detected by the owner. Ticks were
* Correspondence: volkhard.kempf@kgu.de
University Hospital, Goethe-University, Institute for Medical Microbiology and identified using standard taxonomic keys (e.g. number of
Infection Control, Frankfurt am Main, Germany legs, shield, genital orifice [17]). For medical reasons and
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Regier et al. Parasites & Vectors (2017) 10:105 Page 2 of 5
to exclude undiagnosed infections, cat serum was taken as described. Once per week (over a total period of 8
in December 2015 by venipuncture of the vena cephalica weeks), 100 μl of the liquid cultures were plated onto CBA
with a sterile 20 G needle. Blood was collected in a plates and incubated as described above. PCR analysis from
serum tube. After coagulation at room temperature for liquid cultures medium was done after 18 days and after
40 min the tube was centrifuged for 10 min at 4000 rpm. 60 days of incubation, respectively.
Serum supernatant was stored at -20 °C.
Because of the elevated anti B. henselae-IgG titer from DNA extraction from blood and liquid cultures
December 2015 and facing the detection of B. henselae DNA from the cat’s blood and the liquid cultures was ex-
DNA in all ticks taken from this cat in between, whole tracted using the DNeasy Blood and Tissue Kit (Qiagen,
blood was taken for medical reasons in September 2016 Hilden, Germany) according to manufacturer’s instructions.
for a detection attempt of B. henselae (by cultivation or
PCR methods). To access the vena cephalica, the hair Polymerase chain reaction
was clipped, the skin disinfected with 70% ethanol and A nested PCR for the detection of the Bartonella 16S
the vein punctured with a sterile 20 G needle. Blood was ribosomal DNA (rDNA) was performed as previously de-
collected in sterile tubes containing 10 μl of ethylendia- scribed using the Taq DNA Polymerase-Kit (Invitrogen,
minetetraacetic acid disodium salt solution (Sigma- Schwerte, Germany) [19, 20]. Furthermore, a PCR detect-
Aldrich, Steinheim, Germany) as anticoagulant. ing the 16S-23S-rRNA internal transcribed spacer (ITS)
region of Bartonella was conducted using the Platinum
Quality control Taq Polymerase-Kit (Invitrogen, Schwerte, Germany) to
The laboratories of the Institute for Medical Microbiology distinguish Bartonella species [21]. PCR detection of the
and Infection Control at the University Hospital of the Bartonella pathogenicity factors badA and virB was con-
Goethe University in Frankfurt (Germany) undergo a ducted with the Pwo SuperYield DNA Polymerase (Roche,
strict quality control management according to accredited Mannheim, Germany). All PCR primers and annealing
standard operating procedures (laboratory accreditation temperatures are listed in Table 1. Positive and a negative
according to ISO 15189:2007 standards; certificate (water) control were always included. DNA was amplified
number D-ML-13102-01-00, valid through January 25th, in a Biometra T3000 thermocycler. Products were sepa-
2021). There was no increase of Bartonella-positive cases rated on an agarose gel, ethidiumbromide-stained and
during this study; therefore, the possibility of DNA con- visualized under UV light.
tamination from non-study sources is highly unlikely.
Sequencing and alignment
DNA-extraction from ticks 16S rDNA and ITS PCR products were sequenced
Ticks were removed from their storage tubes with a (GATC, Konstanz, Germany) with both, forward and
sterile forceps, rinsed once in ethanol and twice in reverse primers. Sequences were checked using Chromas
sterile water. After grinding each tick with a dispos- software (Technelysium, Version 2.6, South Brisbane,
able sterile mortar and pestle, DNA was extracted Australia), aligned and compared to B. henselae strain
with the QIAamp DNA Mini kit (Qiagen, Hilden, BM1374165 (GenBank: HG969191.1) using Clone Manager
Germany) according to the manufacturer’s instruc- Professional Suite version 8 (Scientific and Educational
tions. To prevent DNA cross-contamination, each tick Software, Denver, USA).
was processed individually by using new forceps,
tubes and mortars and pestles. Extraction procedure Immunofluorescence assay
was verified using specific pathogen-free ticks (Insect Indirect immunofluorescence assay (IIFA) was performed
Services, Berlin, Germany) in which Bartonella spp. using the Bartonella henselae/ Bartonella quintana (IgG)
was not detected (data not shown). kit (Euroimmun, Lübeck, Germany) with some modifica-
tions. Serum dilution series from 1:20 to 1:2,560 were
Culturing of blood samples screened for Bartonella cat IgG antibodies. A 1:100 dilu-
A hundred μl of blood was immediately plated onto tion of Alexa Fluor 488-conjugated AffiniPure Goat Anti-
Columbia blood agar (BD, Heidelberg, Germany), chocolate Cat IgG (Jackson ImmunoResearch laboratories, West
agar plates (Oxoid, Wesel, Germany) moreover, 100 μl were Grove, USA) was used as secondary antibody. The test
suspended in fresh, quality-controlled Bartonella-liquid- was evaluated as positive when specific fluorescence was
medium [18]. Due to the limited amount of cat blood, no detected at a titer of ≥ 1:64 [22].
higher volumes were available for the inoculation of liquid
cultures. Bacterial cultivation was performed for 8 weeks at Results
37 °C with 5% CO2 and 95% humidity. The residual blood All ticks were female, adult, half- to fully-engorged and
was frozen at -80 °C overnight, thawed at 37 °C and plated were identified as Ixodes ricinus. One feeding tick, whichRegier et al. Parasites & Vectors (2017) 10:105 Page 3 of 5
Table 1 Primer designation, sequences and annealing temperatures of the conducted PCRs used for the detection of Bartonella spp.
from Ixodes ricinus ticks
Target Primer designation Sequence (5′–3′) Length Annealing Reference
(bp) temperature (°C)
Bartonella spp. 16S rDNA (first round) A-proteo primer AGAGTTTGATC(AC)TGGCTCAGA 1,210 62 °C (1 min) [19]
r-Alpha-sh primer GTAGCACGTGTGTAGCCCA
Bartonella spp. 16S rDNA (nested PCR) Bart CACTCTTTTAGAGTGAGCGGCAA 990 65 °C (1 min) [19]
r-BH CCCCCTAGAGTGCCCAACCA
Bartonella 16S-23S ITS 325 s CTTCAGATGATGATCCCAAGCCTTCTGGCG 489 68 °C (15 s) [21]
1100as GAACCGACGACCCCCTGCTTGCAAAGCA
Bad A head region badAf8 TCGAATCTTGCGCTTACAGGAGC 325 59 °C (30 s) Present study
BadA_head_reverse CACCGTCAGTCGACTTCCCT
Vir B7 of the VirB/D4-type-IV- VirB7_for GCTGGAAAACGAAAAAGCAA 103 55 °C (30 s) Present study
secretion-system
VirB7_rev ACGCGCAATCTCCATAGTGT
was removed from the cat in November 2015, was tested (Rastatt, Germany) is only 35 km away from Lembach,
positive for B. henselae in 16S rDNA PCR analysis. In France, where a previous study showed highest prevalence
December 2015, the same cat’s serum was screened for of B. henselae in ticks in Europe (38% in nymphs and 12%
anti-Bartonella IgG using an indirect immunofluores- in adult ticks) indicating that there might be an increased
cence assay (IIFA), revealing a titer of 1:640 (cut-off: prevalence of Bartonella-infected ticks in this area [20].
1:64 [22]). No serum was available from September 2016 Cats, especially roaming cats, have a high risk of being
for determination of anti-Bartonella IgG. Subsequently, infested with ticks and other ectoparasites such as fleas
between March and June 2016, ten more feeding ticks which can harbor or transmit Bartonella spp. and other
were removed from the same cat and tested positive for infectious agents such as Anaplasma spp. [10, 11, 20, 23].
B. henselae via PCR amplification of 16S rDNA, 16S- In this case, due to a strict ectoparasite control, no fleas
23S-ITS, virB- and badA (Fig. 1). PCR products of the were detected on the cat.
16S rDNA and ITS were sequenced and alignment Bartonella adhesin A (BadA) mediates adhesion of
showed 100% sequence homology each between all 11 Bartonella spp. to endothelial cells and the extracellular
ticks and also to B. henselae strain BM1374165 (Positions: matrix proteins [24]. The VirB/VirD4 type IV secretion
ITS: 1483445-1483766, 16S rDNA: 1484693-1485539) system (VirB) translocates Bartonella effector proteins
(GenBank: HG969191.1) (see Additional file 1: Figure S1 (Beps) into endothelial host cells, e.g. inhibiting apop-
and Additional file 2: Figure S2). No Bartonella DNA was tosis, and inducing a proinflammatory phenotype, which
detected in the cat’s blood taken in September 2016 and is responsible for the chronicity of the infection and
in six different cultural attempts from continuously in- involved in the cell invasion process of Bartonella spp.
cubated liquid cultures. Blood plated on solid media [25, 26]. We detected the DNA of badA and virB in all
and suspended in liquid media remained negative over eleven ticks analyzed herein. This indicates that these
an incubation period of 8 weeks. two Bartonella pathogenicity factors are at least present
in the genomes of the detected B. henselae and might
Discussion give clues for estimating the extent of the potential
Bartonella spp. are highly prevalent and are found in ticks health threat for humans and animals infected with
all over the world [11]. The sampling site of this study those bacteria.
Fig. 1 PCR products from the 16S-23S-ITS-, virB- and the badA-PCR. Results conducted from DNA of the ten ticks collected from March to June
2016. Positive control: Bartonella henselae Houston ATCC 49882, Negative control: distilled water (representative example)Regier et al. Parasites & Vectors (2017) 10:105 Page 4 of 5
The cat examined in this study was tested seropositive single blood meal. However, infection of humans and
for Bartonella spp. in December 2015 (titer 1:640). animals might be possible, since transstadial transmis-
Clearance of bacteremia due to presence of anti-Bartonella sion of Bartonella spp. in I. ricinus occurs when larvae
IgG antibodies could be a possible reason for the negative or nymphs feed on infected hosts and progress into the
results of the cultures and PCR from the cat’s blood drawn next life stage (larvae to nymph or nymph to adult tick)
in September 2016. When infected with the murine patho- [14]. Transovarial transmission of Bartonella spp. by
gen B. grahamii, immunocompromised mice cleared the ticks is not yet fully resolved. Unengorged larvae were
resulting intraerythrocytic bacteremia after administration found to harbor Bartonella DNA. Here, vertical trans-
of IgG antibodies obtained from immunocompetent mice mission of Bartonella spp. might be the explanation for
[27]. In another study, cats were shown to clear Bartonella presence of bacteria, if those larvae did not have an un-
bacteremia within 1–8 months after being experimentally detected blood meal [30]. Furthermore, B. henselae was
inoculated with B. henselae subcutaneously [28]. As the cat detected in eggs from female ticks which were fed with
described herein had a significant serum IgG titer against infected blood but no Bartonella DNA was amplified
B. henselae, this might indicate that it had already cleared from the larvae eclosed from those eggs [14].
the bacteremia thereby explaining the several negative PCR
and cultivation attempts from the peripheral blood. An- Conclusions
other possible reason for the lack of viable Bartonella or In summary, this case study shows prevalence of Bartonella
Bartonella DNA in the blood could be that bacteremia was spp. in a cat and their ectoparasites (ticks). The circulation
below the detection limit at the time of blood withdrawal. of B. henselae is maintained by ectoparasites and animals.
This hypothesis is supported by a study in which alter- A lot more research has to be done to elucidate the role of
nating periods of bacteremia were observed in a naturally ticks in the transmission of B. henselae to estimate the risk
infected cat over a period of 24 months, with periods of of infection to humans and pets.
high bacteremia and periods where blood cultures were
found to be negative [28].
Additional files
Furthermore, using a B. tribocorum rat infection model,
skin dendritic cells have been described to act as vehicles Additional file 1: Figure S1. Alignment 16S rDNA. (DOCX 14 kb)
from the primary site of infection (skin) towards the blood Additional file 2: Figure S2. Alignment 16S-23S-ITS. (DOCX 14 kb)
stream depending on the function of the Bartonella
effector protein E (BepE) [29]. Accordingly, the DNA of
Abbreviations
all ticks analyzed in our case report contained DNA en- badA: Bartonella adhesin A gene; Bep: Bartonella effector protein;
coding for the VirB/D4 secretion system (injecting BepE DNA: Deoxyribonucleic acid; IgG: Immunoglobulin g; IIFA: Indirect
into eukaryotic cells) showing that this machinery is immunofluorescence assay; ITS: Internal transcribed spacer; PCR: Polymerase
chain reaction; virB: VirB/VirD4 type IV secretion system gene
present in our B. henselae-genome. This suggests that B.
henselae might in fact preferentially occupy the dermal Acknowledgements
niche of cats to enhance vector acquisition by ticks. The authors thank Corinna Illich, Carmen Jung, Rebecca Kaufmann, Heike
Podlich, Claudia Stolz and Yael Wiegand for excellent technical assistance.
The origin of B. henselae DNA found in the adult I.
This paper has been sponsored by Bayer Animal Health in the framework of
ricinus ticks of this survey remains speculative. Ticks the 12th CVBD World Forum Symposium.
undergo three life stages as larvae, nymphs and adult
ticks. Each life stage takes one single blood meal, Funding
This work was partially supported by a grant from the Bayer Animal Health
providing three possibilities of being infected with B. Company, Leverkusen, Germany and by the Robert Koch-Institute, Berlin,
henselae or other infectious agents. We consider infec- Germany (Bartonella consiliary laboratory, 1369–354). Funding parties had no
tion of the adult ticks examined in this study with B. influence on data analysis, data interpretation, or writing of the manuscript.
henselae at an earlier life stage unlikely, since sequen-
Availability of data and materials
cing of PCR products showed 100% sequence homolo- The data supporting the conclusions of this article are included within the
gies for each analyzed (gene) sequence. This points to article.
the possibility, that all ticks became infected by the
same host, the cat; however 16S and 16S-23S-ITS Authors’ contributions
YR performed cat patient care, YR and WB performed diagnostics and
genes are known to be highly conserved among B. experiments, YR and VK planned the study and wrote the paper. All authors
henselae isolates. Whether the B. henselae found in read and approved the final manuscript.
ticks were viable remains unclear since we prioritized
DNA extraction and therefore did not attempt cultiva- Competing interests
The authors declare that they have no competing interests.
tion of bacteria from ticks.
Engorged, infected, adult hard ticks pose a low risk to Consent for publication
human or animal health since they usually only have a Not applicable.Regier et al. Parasites & Vectors (2017) 10:105 Page 5 of 5
Ethics approval 22. Glaus T, Hofmann-Lehmann R, Greene C, Glaus B, Wolfensberger C, Lutz H.
VK holds a permit of the state veterinary board of Hesse/Germany allowing Seroprevalence of Bartonella henselae infection and correlation with disease
to analyze animal samples for medical reasons to detect Bartonella status in cats in Switzerland. J Clin Microbiol. 1997;35:2883–5.
infections. Blood was taken for medical reasons. 23. Carrade DD, Foley JE, Borjesson DL, Sykes JE. Canine granulocytic
anaplasmosis: a review. J Vet Intern Med. 2009;23:1129–41.
Received: 17 December 2016 Accepted: 17 February 2017 24. Riess T, Andersson SG, Lupas A, Schaller M, Schafer A, Kyme P, et al.
Bartonella adhesin a mediates a proangiogenic host cell response. J Exp
Med. 2004;200:1267–78.
25. Schülein R, Dehio C. The VirB/VirD4 type IV secretion system of Bartonella is
References essential for establishing intraerythrocytic infection. Mol Microbiol.
1. Versalovic J, Jorgensen JH, Funke G, Warnock DW, Landry ML, Carroll KC. 2002;46:1053–67.
Manual of clinical microbiology. 10th ed. Washington DC: American Society 26. Schmid MC, Schülein R, Dehio M, Denecker G, Carena I, Dehio C. The VirB
for Microbiology; 2011. type IV secretion system of Bartonella henselae mediates invasion,
2. Rolain JM, La Scola B, Liang Z, Davoust B, Raoult D. Immunofluorescent proinflammatory activation and antiapoptotic protection of endothelial cells.
detection of intraerythrocytic Bartonella henselae in naturally infected cats. Mol Microbiol. 2004;52:81–92.
J Clin Microbiol. 2001;39:2978–80. 27. Koesling J, Aebischer T, Falch C, Schülein R, Dehio C. Cutting edge: antibody-
3. Kordick DL, Brown TT, Shin K, Breitschwerdt EB. Clinical and pathologic mediated cessation of hemotropic infection by the intraerythrocytic mouse
evaluation of chronic Bartonella henselae or Bartonella clarridgeiae infection pathogen Bartonella grahamii. J Immunol. 2001;167:11–4.
in cats. J Clin Microbiol. 1999;37:1536–47. 28. Abbott RC, Chomel BB, Kasten RW, Floyd-Hawkins KA, Kikuchi Y, Koehler JE,
4. Chomel BB, Wey AC, Kasten RW, Stacy BA, Labelle P. Fatal case of endocarditis et al. Experimental and natural infection with Bartonella henselae in
associated with Bartonella henselae type I infection in a domestic cat. J Clin domestic cats. Comp Immunol Microbiol Infect Dis. 1997;20:41–51.
Micorbiol. 2003;41:5337–9. 29. Okujava R, Guye P, Lu YY, Mistl C, Polus F, Vayssier-Taussat M, et al. A
5. Breitschwerdt EB, Broadhurst JJ, Cherry NA. Bartonella henselae as a cause of translocated effector required for Bartonelladissemination from derma to
acute-onset febrile illness in cats. JFMS Open Reports. 2015;1(2). doi:10.1177/ blood safeguards migratory host cells from damage by co-translocated
2055116915600454. effectors. PLoS Pathog. 2014;10(6):e1004187.
6. Bergh K, Bevanger L, Hanssen I, Loseth K. Low prevalence of Bartonella 30. Rynkiewicz EC, Hemmerich C, Rusch DB, Fuqua C, Clay K. Concordance of
henselae infections in Norwegian domestic and feral cats. Acta Pathol bacterial communities of two tick species and blood of their shared rodent
Microbiol Immunol Scand. 2002;110:309–14. host. Mol Ecol. 2015;24:2566–79.
7. Solano-Gallego L, Hegarty B, Espada Y, Llull J, Breitschwerdt E. Serological
and molecular evidence of exposure to arthropod-borne organisms in cats
from northeastern Spain. Vet Microbiol. 2006;118:274–7.
8. Relman DA, Loutit JS, Schmidt TM, Falkow S, Tompkins LS. The agent of
bacillary angiomatosis. An approach to the identification of uncultured
pathogens. N Engl J Med. 1990;323:1573–80.
9. La Perkocha, Geaghan SM, Yen TS, Nishimura SL, Chan SP, Garcia-Kennedy
R, et al. Clinical and pathological features of bacillary peliosis hepatis in
association with human immunodeficiency virus infection. N Engl J Med.
1990;323:1581–6.
10. Foil L, Andress E, Freeland RL, Roy AF, Rutledge R, Triche PC, et al. Experimental
infection of domestic cats with Bartonella henselae by inoculation of
Ctenocephalides felis (Siphonaptera: Pulicidae) feces. J Med Entomol.
1998;35:625–8.
11. Billeter SA, Levy MG, Chomel BB, Breitschwerdt EB. Vector transmission of
Bartonella species with emphasis on the potential for tick transmission. Med
Vet Entomol. 2008;22:1–15.
12. Sormunen JJ, Penttinen R, Klemola T, Hanninen J, Vuorinen I, Laaksonen M,
et al. Tick-borne bacterial pathogens in southwestern Finland. Parasit
Vectors. 2016;9:168.
13. Schouls LM, van de Pol I, Rijpkema SG, Schot CS. Detection and identification
of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch
Ixodes ricinus ticks. J Clin Microbiol. 1999;37:2215–22.
14. Cotté V, Bonnet S, Le Rhun D, Le Naour E, Chauvin A, Boulouis H-J, et al.
Transmission of Bartonella henselae by Ixodes ricinus. Emerg Infect Dis.
2008;14:1074–80.
15. Reis C, Cote M, Le Rhun D, Lecuelle B, Levin ML, Vayssier-Taussat M, et al.
Vector competence of the tick Ixodes ricinus for transmission of Bartonella
birtlesii. PLoS Negl Trop Dis. 2011;5:e1186.
16. Telford SR, Wormser GP. Bartonella spp. transmission by ticks not
established. Emerg Infect Dis. 2010;16:379–84. Submit your next manuscript to BioMed Central
17. Arthur D. British ticks. London: Butterworths; 1963. and we will help you at every step:
18. Riess T, Dietrich F, Schmidt KV, Kaiser PO, Schwarz H, Schafer A, et al.
Analysis of a novel insect cell culture medium-based growth medium for • We accept pre-submission inquiries
Bartonella species. Appl Environ Microbiol. 2008;74:5224–7. • Our selector tool helps you to find the most relevant journal
19. Dauga C, Miras I, Grimont PA. Identification of Bartonella henselae and B.
• We provide round the clock customer support
quintana 16s rDNA sequences by branch-, genus- and species-specific
amplification. J Med Microbiol. 1996;45:192–9. • Convenient online submission
20. Dietrich F, Schmidgen T, Maggi RG, Richter D, Matuschka F-R, Vonthein R, et • Thorough peer review
al. Prevalence of Bartonella henselae and Borrelia burgdorferi sensu lato DNA
• Inclusion in PubMed and all major indexing services
in Ixodes ricinus ticks in Europe. Appl Environ Microbiol. 2010;76:1395–8.
21. Cherry NA, Maggi RG, Cannedy AL, Breitschwerdt EB. PCR detection of • Maximum visibility for your research
Bartonella bovis and Bartonella henselae in the blood of beef cattle. Vet
Microbiol. 2009;135:308–12. Submit your manuscript at
www.biomedcentral.com/submitYou can also read
