Bioscience Research - Innovative Scientific Information & Services ...
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Available online freely at www.isisn.org
Bioscience Research
Print ISSN: 1811-9506 Online ISSN: 2218-3973
Journal by Innovative Scientific Information & Services Network
RESEARCH ARTICLE BIOSCIENCE RESEARCH, 2020 17(2): 1511-1520. OPEN ACCESS
Effect of aquatic plants (Duck Weed and Water
Hyacinth) on physico-chemical and microbial
activities of vermicompost
Yasser Thabet A. Moustafa1, Tarek R. Elsayed2, Mohamad F. El-Dahshour3,
Safwat A.A. Gomah1, Lixin Zhang4 and Nabil S. A. Mustafa5*
1Central Lab for Aquaculture Research (CLAR), Agricultural Research Center Egypt
2 Department of Microbiology, Faculty of Agriculture, Cairo University, Giza, Egypt
3 Fertilization Technology Dept., Agricultural and Biological Division Egypt
4 College of Life Sciences, Northwest A&F University, Yangling 712100, Shaanxi, China
5Pomology Dept, National Research Centre (NRC) Egypt
*Correspondence: nabilhotline@yahoo.com Received 12-04-2020, Revised: 22-06-2020, Accepted: 26-06-2020 e-Published:
30-06-2020
Vermicompost is considered one of high-quality organic fertilizer forms. The aim of the current work +
water hyacinth) and (cow dung + duckweed) at the Central Lab for aquaculture research (CLAR),
Agricultural Research Center. The samples of these vermicompost types were delivered was to
investigate the role of aquatic plants (i.e. water hyacinth and duckweed) in improving vermicompost
quality. Different types of vermicompost were produced using (cow dung alone), (cow dung to determine
bio-chemical parameters (i.e. nutrients, amino acids and growth promoters content) at the National
Research Centre (NRC) as well as total bacteria and antibiotic resistant bacteria counts were compared
among these different prepared vermicompost types using rt-PCR quantification of 16S rRNA genes and
selective plating techniques respectively at faculty of agriculture, Cairo University. Furthermore, PCR
detection of nifHgene was determined in total community DNA extract from studied different
vermicompost types. The obtained results indicated that adding water hyacinth to cow dung during
vermicomposting improved vermicompost studied parameters (dry matter, organic matter and both of
nitrogen and phosphorus content, while adding duckweed to cow dung during vermicomposting
increased potassium content in comparison with the other tested treatments. Moreover, vermicompost
produced from mixture of (cow dung + water hyacinth) surpassed all tested treatments in amino acids
and growth promoters content. Also, vermicompost produced from (cow dung + water hyacinth) mixture
was characterized by higher bacterial populations, the abundance of diazotrophs and significantly lower
population of antibiotic resistant bacteria compared to the (cow dung + duckweed) and control (cow
dung alone) vermicompost samples. This study emphasizes that water hyacinth can be used as an
enhancer additive component during vermicomposting.
Keywords: Vermicompost quality, aquatic plants, water hyacinth, duckweed, physicochemical, growth promoters, amino
acids content,diazotrophs.
INTRODUCTION several problems were emerged with adverse
As a consequence of the excessive use of impacts on the environment and consumer’s
agrochemicals (mineral fertilizers and pesticides) health (i.e. depletion of soil fertility and microbial
to maximize the productivity of various field crops, activity) (Rahman et al., 2017). Nowadays, moreMoustafa et al., Physico-chemical and microbial activities of vermicompost
attention is focused on the utilization of organic irrigation, traffic, water quality, hydraulic and
fertilizers in different forms for its positive impacts hydroelectric infrastructures (Hasanand
on environment (i.e. restoration of soil fertility) and Chakrabarty 2009 & Hasan, and Chakrabarti,
secure safe food for population. 2009). Several studies indicated that although,
In Egypt a huge amount of agricultural wastes water hyacinth is one of the most noxious weeds
(30-35 million tons) is produced annually (Abou in tropical and subtropical regions, many attempts
Hussein and Sawan 2010). Conversion these were made to eliminate or control it. Harnessing
wastes into compost by means of turned piles has its considerable productivity is considered as a
resulted in a final product with poor physical and sustainable and possibly less expensive method
chemical characteristics; thereby of control. Water hyacinth can be used as a green
vermicomposting was nominated as an alternative dung, compost and mulch for soil improvement
method of transforming these wastes into a because it has high nutritive value (high nitrogen
valuable organic fertilizer. Vermicompost is content) (Yang Huazhu et al., 2001,Chu JianJun
considered one of the organic fertilizer forms that et al., 2006 and Heuzé et al., 2015).
got a lot of attention recently as a result of its In regard to duckweed, Reddy and
environmentally friendly manner and several DeBusk(1985) reported that due to highly N
merits that can be achieved by using this type of content (crude protein- 20-33%) of the small leaf
organic fertilizers. Vermicompost is resulted from of duckweed, it is nominated for many purposes
feeding earthworms on agricultural wastes. (i.e. animal feed and green dung). Later, Ahmad
Besides, the interaction between earthworms and et al., (1990) indicated that there is a great
microorganisms leads to degradation of organic potential to utilize duckweed as a complement to
material whether cow dung, fish sludge or other mineral fertilizer in rice field that led to increase
farm’s animals and crops wastes. Several studies plant height, straw and grain yield, N, P and K
indicate that the vermicompost is rich in nutrients contents of rice plants and in available N, P and K
(mainly nitrogen, potassium and phosphate), contents in soil.
different growth promoters (i.e. IAA, gibberellins Also, several studies conducted on duckweed
and cytokinines) (Edwads and Burrows,1988; as green dung and concluded that duckweed as
Orozco et al., 1996; Tomati et al., 1988 green dung combined with chemical fertilizer
,Grappelliet al., 1987;Jeyabal and Kuppuswamy application provides an approach for increasing
2001 and Jouquet et al., 2010) and antimicrobials the rice yield without increasing inputs of N
(Adhikary, 2012). Moreover, the applying of fertilizer and thereby provides a financially
vermicompost raises the content of total attractive option for farmers to achieve
antioxidants, carotenes, lycopene, carbohydrates, environmental integrity and ensure food security
vitamin C, proteins, dry matter, iron and zinc in in rice production (Yuanlin et al., 2017).
cultivated plants (Gutiérrez-Micely et al., 2007; The main goal of this study was to investigate
Shankar et al., 2009; Sinha et al., 2011; Ghosh et the potentiality of using both water hyacinth and
al., 2013). duckweed as raw material for vermicompost and
However, many factors affect vermicompost their impact on the quality of the vermicompost
quality, the main factor of these is the type of product.
wastes material (i.e. cow dung, pig dung, fish
sludge, or horse manure, and other crops wastes) MATERIALS AND METHODS
(Bohlen, 2020). Moreover, mixing animal dungs
(either. cow dung, fish sludge, pig dung or horse Preparing duckweed (DW) and water hyacinths
dung) with crops residues (i.e banana leaves, (WH) for vermicomposting:
sugarcane, duckweed and water hyacinth) as Duckweed (DW) was collected from the
feeding materials for earthworms showed different drainage canals around the Central Laboratory for
yield biomass and quality of produced Aquaculture Research (CLAR) and cultivated on
vermicomposts (Dominguez, 2004 and Joshi et fish effluent ponds in a concrete pond. After two
al., 2015; Sartaj et al., 2016). weeks, duckweed was harvested and subjected to
At the same moment, water hyacinth is of a air-drying for 24 hours and then in an oven at
major environmental concern in many countries. It 50C for another 24 hours to reach a constant
quickly invades large water areas, due to its high weight. Thereafter, it was grinded and stored in
rate of vegetative propagation, and forming dense plastic bags until used directly with fresh cow
mats that obstructs waterways. It affects all water- dung to feed earthworm and produce
based economic activities, including fishing, vermicompost.
Bioscience Research, 2020 volume 17(2): 1511-1520 1512Moustafa et al., Physico-chemical and microbial activities of vermicompost
For water hyacinth (WH), only plant leaves Growth promoters Amino acid analysis:
were collected from plants in the drainage canals To determine total free amino acids, the
adjacent to the CLAR and subjected to drying in modified of ninhydrine colorimetric method that
the oven at 50C for 48 hours to reach a constant described by (Rosein, 1957 and Selim et al.,
weight, after that it was grinded and stored in 1978) was used for this purpose. Growth
plastic bags until used directly with fresh cow promoters in samples of vermicompost were
dung to feed earthworm and produce estimated according to the method described by
vermicompost. (Dobrev et al., 2005).
Vermicompost production: Microbiological analysis of vermicompost
Fresh cow dung was mixed with either dried samples
duckweed or dried water hyacinth at a ratio of 2:3, Sampling and sample preparation
respectively, and moistened to 60-70% in Five grams from vermicompost samples were
styrofoam boxes with dimensions of 60× 40× 30 placed in sterile Stomacher bags and treated by a
cm. After 24 h, three species of earthworm Stomacher 400 Circulator for 60 s at middle speed
(Eisenia fetida; Perionyx excavatus and after adding 45 ml sterile 0.85% NaCl. The
Lumbricus rubellus) were added to the media at a Stomacher blending step was repeated three
rate of 50 g worm per 1000g media. For eight times and the microbial suspension was obtained.
weeks the boxes were checked weekly and re-
moistened and mixed until the vermicompost Estimation of total viable bacteria count
matured. All boxes were kept indoor and the Tenfold serial dilution of the microbial
temperature maintained between 20-25℃ during suspensions obtained with the protocol described
the vermicompost maturation period. At harvest, above made with sterile 0.85% NaCl were plated
vermicompost was checked manually on white onto plate count agar medium (PCA) for the
surface plastic and the adult as well as pre-adult estimation of total viable counts, counts of colony
earthworms were removed then the vermicompost forming units (CFU) were estimated after three
was returned to the boxes again for one more days of incubation at 28°C and were calculated
month. Later, the vermicompost was checked per gram vermicompost. The total antibiotic-
again and all hatched earthworms were removed. resistant bacteria were estimated by planting the
The harvested vermicompost was packed in same dilution onto PCA medium sublimated with
plastic bags and sent for the analysis instantly. penicillin, ampicillin, erythromycin and tetracycline
to final concentration of 20mg/L.
Physiochemical analysis for vermicompost:
Vermicompost samples were dried in a Total community DNA extraction from
ventilated oven at 70 oC to a constant weight. vermicompost samples
Samples were grinded in stainless steel mill with TC-DNA was extracted from 250 mg
0.5 mm sieve and kept in plastic containers for vermicompost of each treatment (three replicates
chemical analysis. The samples (1 g of each each). D Neasy Power Soil kit was used for the
sample) were dry-ashed in a muffle furnace at 450 extraction according to the manufacturer’s
oC for 6 hours for determination ash and organic protocol. TC-DNA was diluted (1:5) using Tris-
matter content. EDTA and stored at -20. The integrity and quality
Macronutrients were extracted using the dry of extracted TC-DNA were confirmed using
ashing digestion method (Chapman and Pratt, agarose gel electrophoresis and Nanodrop 2000
1978). Nitrogen was determined by using the spectrophotometer (Thermo Fisher Scientific).
Kjeldahl method, the ash was dissolved in HCl
(2N) and phosphorus was photometrical Quantification of total bacteria in TC-DNA
determined in the digested solution using vanado- using 16S rRNA gene
molybdate color reaction according to the method The total bacterial 16S rRNA gene copy
described by Jackson (1973). Potassium was numbers were estimated in TC-DNA of compost
measured in the digested suspension using the samples using the universal primers (Eub338 and
Flame-photometer, (Eppendorof, DR Lang). Eub518) according to (Fierer et al., 2005).
Organic matter content was determined according
to Walkely and Black (1934).
Bioscience Research, 2020 volume 17(2): 1511-1520 1513Moustafa et al., Physico-chemical and microbial activities of vermicompost
Table 1: Primers used in this study
Target Primers Size
Sequence Ta Reference
gene used (bp)
Eub338 ACTCCTACGGGAGGCAGCAG
16S rRNA 55°C 123 Fierer et al. 2005
Eub518 ATTACCGCGGCTGCTGG
DVV ATIGCRAAICCICCRCAIACIACRTC
nifH 53°C 454 Ando et al.2005
IGK3 GCIWTHTAYGGIAARGGIGGIATHGGIAA
A real-time PCR detection system (Step One Plus vermicompost produced from cow dung alone
Real-Time PCR System - Thermo Fisher recorded the significantly highest content of Ash
Scientific) was used. Real time PCR was (51.6%), meanwhile vermicompost produced from
performed with HOT FIREPol® EvaGreen® qPCR (cow dung + WH) and (cow dung + DW) came in
Mix Plus (Solis BioDyne, Estonia) in a final the second rank without any significant
volume of 20 µL. Real time PCR conditions were differences between both of them.
as follow: Activation step for 12 min at 95°C Moreover, for C: N ratio , data in table 2
followed by 40 cycles of 95°C for 30s, 60°C for 1 showed that there are no markedly differences
min, 72°C for 1 min and a final elongation step at found between tested treatments. However, data
72°C for 5 min. Primers sequences are listed in related to nitrogen content revealed that
Table 1. vermicompost produced from (cow dung + WH)
recoded the highest nitrogen content followed by
PCR- based detection of genes encoding plant that produced from (cow dung + DW). The
growth promoting related functions. vermicompost produced from cow dung
The extracted TC-DNA was analyzed by PCR to individually was recorded the lowest value of
amplify marker genes as biological indicator for nitrogen content.
soil fertility such as nifH gene encoding the The same trend was observed in “P” content ,
dinitrogenasereductase. The nifH gene is the whereas the highest “P” content was recorded in
biomarker most widely used to study the ecology vermicompost produced from (cow dung + WH)
and evolution of nitrogen-fixing bacteria. Primers followed by (cow dung + DW) ,which did not differ
sequences are listed in Table 1. significantly from the vermiompost from (cow dung
alone).
RESULTS AND DISCUSSION The “K” content showed different trend
whereas the highest K content noticed in
Physico-chemical parameters: (cowdung+ DW) followed by that of (cow dung
Data in table (2) reveal that there is a relation alone), meanwhile vermicompost produced from
between dry weight and humidity whereas (cow dung + WH) recoded the lowest content of
vermicompost that produced from only cow dung “K”.
without additive aquatic plants recoded higher These results can be attributed to releasing
humidity. Although vermicompost produced by nutrients (N, P, K and other nutrients) from used
mixing (cow dung + WH) recorded the lowest organic wastes for feeding earthworm. Ndegwa
value of humidity it produced the higher value of and Thompson (2001) reported that the important
dry matter than those produced from (cow dung + plant nutrients such as nitrogen, potassium,
DW) or cow dung alone. These results indicated phosphorus, and calcium present in the feed
that dry matter of vermicompost can be enhanced material are converted through microbial action
by adding water hyacinth (7.53g) and duckweed into forms that are much more soluble and
(7.33g) during vermicomposting. available to the plants than those in the parent
In respect for organic matter, vermicompost substrate. Several studies supported these finding
produced from (cow dung + WH) recorded the whereas they indicated that activities of
significantly highest organic matter followed by endosymbiotic microbes and gut enzymes of
that produced from (cow dung + DW) treatment. earthworm aid in transformation of ingested
The significantly lowest organic matter observed organic matters into vermicompost constituting
with vermicompost produced from (cow dung essential macronutrients such N, P, K in plant
alone). available forms (Kaushik and Garg 2004and
Chaulagain et al., 2017).
Also, data concerning ash indicated that
Bioscience Research, 2020 volume 17(2): 1511-1520 1514Moustafa et al., Physico-chemical and microbial activities of vermicompost
Table 2: shows different physico-chemical parameters as affected by adding duckweed or water
hyacinth to the fresh cow dung.
Fresh Dry Organic
Humidity
Treatments Weight Weight matter Ash C / N ratio N (%) P (%) K (%)
%
(g) (g) O.M (%)
Cow dung (CD) 10 7.27c 27.34a 21.06 c 51.6a 11.65 a 1.05 c 0.40 b 2.05 b
Cow dung + (WH) 10 7.53a 24.67c 28.49 a 46.84b 11.64 a 1.42 a 0.90 a 1.80 c
Cow dung + (DW) 10 7.33b 26.67b 26.45 b 46.88b 11.62 a 1.32 b 0.41 b 2.12 a
Means were represented as average of replicates.
Different letters are express for significant differences while the same letters are non-significant at L.S.D.
p>0.05. Whereas Duckweed:DW;water hyacinth:WH.
Since 1972, earthworms are known as voracious nitric N (Cegarra et al. 1992). Orozco et al. (1996)
feeders on organic wastes (whether animal also showed that in addition to increasing N
wastes or crops residues). Earthworm used a availability in vermicompost, P, K, Ca, and Mg
small portion of nutrients for their body growth, availability in the vermicompost are also greater
they excrete a large part of these consumed than in the starting feed material.
wastes in half digested form. The intestine of Supplementation cow dung with additives
earthworms rich with a wide spectrum of material (agro-wastes such as banana wastes
microorganisms, enzymes, hormones, etc. these saw dust) may lead to improving quality of
half -digested substrate decompose rapidly and vermicompost, whereas Chaulagain et al., (2017)
converted into vermicompost by microorganisms showed that high quality vermicompost containing
within short time (Edwards and Lofty 1972). nitrogen, phosphorus, potassium and the greater
Moreover, they indicated that about 5–10% of microbial population can be obtained from the
ingested material is absorbed into the tissue for mixture of cow dung and banana wastes as
earthworm’s growth and metabolic activity and compared to other mixtures (saw dust and leaf
rest is excreted as vermicast. The vermicast is litter).
mixed with mucus secretion of the gut wall, and According to what aforementioned, the
associated microbes and transformed into nutrient status of vermicompost depends on
vermicompost. inputs or substrates (the type of wastes and its
In addition, Atiyeh et al., (2002) showed that content of nutrient) that offered for feeding
the earthworms certainly fragment the organic earthworms. Physicochemical changes during the
waste substrates increase rates of mineralization, degradation of organic matter (vermicomposting)
rapidly converting the wastes into humus-like may be carried out through enzymatic digestion,
substances. Another study by Suthar (2007) enrichment by minerals, which in turn depend on
showed that earthworm processed waste material types of organic and inorganic materials, which
contains higher concentration of exchangeable interpret differences in nutrients content in
minerals due to enhanced microbial activity during vermicompost according to differing mixture cow
the vermicomposting process, which consequently dung alone or supplemented with either duckweed
enhances the rate of mineralization. Also, Rupani or water hyacinth. These findings supported with
et al. (2013) reported that total nitrogen content in findings of (Kale 1998; Suthar 2007) who
vermicomposts may be ranged quite widely from concluded that different nitrogen pattern and
0.1% to 4% or more depending on the organic mineralization activities depend on total amount of
wastes used to feed earthworm. Lower K content nitrogen in the initial waste and on the earthworm
in vermicompost is reported by Kale (1995) activity in the waste decomposition.
(0.63%) in vermicompost produced from a mixture
of cow dung + Banana leaves, although banana Amino acids and growth promoters content:
waste considered rich in K content. Meanwhile, Vermicompost produced from (cow dung
phosphorus content may be ranged from 0.1%- +WH) surpassed other treatments in amino acids
0.3% in vermicompost as reported by (Kale, content and growth promoters content (Table3).
1995). Whereas, vermicompost from (cow dung + WH)
The studies on the effect of vermicomposting recoded (0.81mg/g dry weight) followed by
on some components of organic waste showed vermicompost from (cow dung + DW) that
that vermicompost enhances the degree of contained (0.54mg/g dry weight). Meanwhile, the
polymerization of humic substances along with a vermicompost produced from (cow dung alone)
decrease of ammonium N and an increase of recorded the significantly lowest content of amino
Bioscience Research, 2020 volume 17(2): 1511-1520 1515Moustafa et al., Physico-chemical and microbial activities of vermicompost
acids.
Table 3:shows the impact of adding aquatic plants (Duck weed and Water hyacinth) on
vermicompost amino content and growth promoters.
Amino acids Abscisic GA3 IAA
Treatment
(mg/g dry weight) acid (g/100g) (g/100g) (g/100g)
Cow dung (CD) 0.27 c 0.33 c 1.08 b 0.04 b
Cow dung+ Water Hyacinth (WH) 0.81 a 1.67 a 1.37 a 0.35 a
Cow dung + Duckweed (DW) 0.54 b 0.37 b 0.55 c 0.06 b
Means were represented as average of replicates.
Different letters are express for significant differences while the same letters are non-significant at
L.S.D. p>0.05 . Duckweed :DW; Water hyacinth :WH.
medium were not significantly different between
Regarding the growth promoters as presented different samples Fig(1). However, the CFU
in table 3, vermicompost (cow dung + WH) counts determined for water hyacinth (WH)tended
contained the highest amount of abscisc acid to be higher in total bacterial counts compared to
(1.67g /100g) comparing to the other two other treatments (Log CFU g-1 = 9.98±0.14).
treatments. Also, vermicompost (cow dung + DW)
came in the second rank. Meanwhile, the 16S rRNA gene copy numbers
vermicompost from cow dung alone produced the The average copy numbers of 16S rRNA
lowest value for Abscisic acid. gene counts determined for water hyacinth (WH)
In addition, vermicompost produced from (cow also tended to be higher in compared to other
dung + WH) contained the highest value of GA3 treatments (Log 16S rRNA gene copies g-1 =
(1.37 g /100g) followed by vermicompost from 10.25±0.06).
cow dung alone , while, the vermicompost from
(cow dung + DW) came in the last rank PCR- based detection of genes encoding plant
significantly. growth promoting related functions.
Finally, vermicompost produced from (cow The nifHgene encoding the nitrogenase
dung + WH) had the highest value of IAA followed reductase indicating the presence of nitrogen
by vermicompost from (cow dung + DW). fixing bacterial populations that was detected in
While,the vermicompost from cow dung alone had total community DNA extracted from each
the lowest content of IAA, although the differences compost samples. Our results showed relatively
between vermicompost (cow dung + DW) and higher band intensity for nifHgene amplified from
vermicompost from cow dung alone in IAA content WH TC-DNA followed by DW compared to the
were not significant. cow dung control compost.
These results are in consistence with
Tajbakhsh et al. (2011) who indicated that Antibiotic resistant bacteria counts in different
vermicompost is considered as an excellent vermicompost samples
product since it has desirable esthetics, plant High bacterial populations were detected
growth hormones, higher level of soil enzymes, resistant to different antibiotic such as penicillin,
and greater microbial population, as tends to hold ampicillin, erythromycin and tetracycline (Table 4).
more nutrients over a longer period without However, cow dung +WH characterized by
adversely impacting the environment. significantly lower bacterial population bearing
The plant growth regulators and other plant antibiotic resistant to ampicillin and erythromycin,
growth influencing materials, that is, auxins, while individual CD and (CD + DW) showed
cytokinins, humic substances, etc., produced by almost similar values.
microorganisms have been reported in Satchell (1983) indicated that there were
vermicompost by Atiyeh et al., (2002); Muscolo et changes in soil microbial populations as
al. (1999). The humic materials extracted from consequences of vermicompost application. Few
vermicomposts have been reported to produce reports deal with field trials involving the
auxin-like cell growth and nitrate metabolism of application of vermicompost. Kale et al., (1992)
carrots (Daucuscarota) (Muscolo et al.,1999). studied vermicompost in a rice paddy in India.
Microbiological analysis:
The CFU counts determined on PCA agar
Bioscience Research, 2020 volume 17(2): 1511-1520 1516Moustafa et al., Physico-chemical and microbial activities of vermicompost
Figure 1: Total bacteria counts in different vermicompost samples determined using culture
dependant methods (CFU counts) and in total community DNA (16S rRNA gene copies), the
occurrence of nifH gene in TC-DNA (5 µl of the PCR products) is shown above the graph (three
replicates for each compost type)
Table 4: Antibiotic resistant bacteria counts in different vermicompost samples
Sample Penicillin Ampicillin Erythromycin Tetracycline
Cow dung(CD) 10.82±0.07 a 8.72±0.16 b 10.80±0.05 a 10.82±0.05a
Cow dung +Water Hyacinth
10.81±0.04 a 7.82±0.48 c 9.07±0.026 b 10.81±0.08a
(WH)
Cow dung + Duck Weed (DW) 10.81±0.05 a 9.28±0.03 a 10.79±0.098 a 10.82±0.04a
Means were represented as average of replicates.
Different letters are express for significant differences while the same letters are non-significant at L.S.D.
p>0.05.
more deeply linked to the richer microbial
Significant increases in the colonization of population in vermicompost (Tucker 2005).
soil by microorganisms (including N-fixers, The quality of soil can be explored using
Actinomycetes, spore formers, and Mycorrhizae) molecular detection of marker genes involved in
occurred in the experimental plots compared to biogeochemical cycles (van Elsas & Costa, 2007)
the control plots without added vermicompost. such as the plant growth promoting related
Moreover, Subler et al., (1998) reported that functions as nifHgene encoding the nitrogenase
vermicompost is rich in microbial diversity, reductase (Gaby and Buckley 2012) indicating the
population, and activity .Also,Atiyeh et al.,(2002) presence of nitrogen fixing bacterial populations.
showed that the earthworms certainly fragment However, the abundance of these marker genes
the organic waste substrates stimulate enhanced is influenced by numerous factors such as plant
microbial activity and increase rates of development stage, the content of organic matter.
mineralization, rapidly converting the wastes into In the present study higher abundance of
humus-like substances.Some microbial and microbial populations bearing nifH genes were
enzyme activities are occurring within the gut of detected in WH compost samples (Fig. 1) which is
the earthworm (Alter and Mitchell, 1992). characterized by higher Organic matter content.
The research team at Ohio State University The importance of this study emerged from
has demonstrated that it is not just because of the that plant nutrition through vermicomposts
relatively high levels of nutrients and enables biotechnologically and energetically
micronutrients within earthworm’s castings. The undemanding utilization of by-products or waste
explanation of vermicompost’s influence may be products from a wide range of industrial and
Bioscience Research, 2020 volume 17(2): 1511-1520 1517Moustafa et al., Physico-chemical and microbial activities of vermicompost
agricultural activities, which is one of the ways of the Environmental Issues in Egypt (A Case
increasing soil fertility, the use of which has Study). Journal of Applied Sciences
assumptions of applicability on each agricultural Research, 6(8): 1116-1124.
land. AdhikaryS. (2012). Vermicompost, the story of
organic gold: A Review, Agricultural
CONCLUSION Sciences, 3(7), 905–917.
The results suggesting that vermicompost is a https://doi.org/10.4236/as.2012.37110.
promising organic fertilizer, where it has a Ahmad, Z. ; Hossain, N. S. ; Hussain, S.
considerable growth promoters. Moreover, G. ; Khan, A. H.. (1990). Effect of duckweed
vermicomposting is an effective mean to turn (Lemna minor) as complement to fertilizer
wastes as well as aquatic plants into valuable nitrogen on the growth and yield of rice.
products with economic value that protect the International Journal of Tropical
environment and replenish soil fertility. Finally, Agriculture Vol.8 No.1 pp.72-79.
adding aquatic plants to cow dung during Alter D, Mitchell A (1992) Use of vermicompost
vermicomposting increasing nutrient contents, extract as an aluminum inhibitor in aqueous
amino acids content and microbial population, solution. Commun Soil Sci Plant Anal
particulraly vermicompost produced from (cow 23:231–240
dung + water hyacinth) which is characterized by Atiyeh RM, Lee Edwards CA, Arancon NQ,
higher bio-chemical compostion and bacterial Metzger JD (2002) The influence of humic
populations, and abundance of nitrogen fixing acids derived from earthworm-processed
bacteria with lower population of antibiotic organic wastes on plant growth.
resistant bacteria compared to the DW and BioresTechnol 84:7–14.
Control compost samples. Bohlen P. J. (2002).Earthworms, Encyclopedia of
Soil Science, Marcel Dekker. Inc. USA.
CONFLICT OF INTEREST Cegarra J, Famandez FM, Tercero A, Roig A
The authors declared that present study was (1992) Effects of vermicomposting of some
performed in absence of any conflict of interest. components of organic wastes.Preliminary
results.Mitteilungen-aus-dem-
ACKNOWLEGEMENT hamburgischenzoologischen-museum-und-
This research was accomplished through Institute 89:159–167
cooperation among the National Research Centre, Chapman, H.D. and Pratt, P.T. (1978).Methods of
Central Laboratory for Aquaculture Research analysis for soils, plants and water.University
(CLAR), Agricultural Research Centre (ARC) and of California, Dept. Agric. Sci., USA, 320 p.
Dept. of Microbiology, Faculty of Agriculture, Cairo Chaulagain, A.;, B. Maharjan; R. Pathak; S. Piya;
University. The authors would like to express their S. Chimoriya; I. S; D. P. Gauchan; J.
gratitude for all members for their effort to Lamichhane.(2017).Effect of feeding
accomplish this work and looking forward to materials on yield, quality of vermicompost,
complete the remaining chain of this approach. multiplication and reproduction of
eiseniafoetida. Journal of science,
Copyrights: © 2020@ author (s). engineering and Technology Vol. 13, No.
This is an open access article distributed under the II,,pp 15-25.
terms of the Creative Commons Attribution License Chu JianJun; Ding Yi; ZhuangQiJia.(2006).
(CC BY 4.0), which permits unrestricted use, Invasion and control of water hyacinth
distribution, and reproduction in any medium, (Eichhorniacrassipes) in China. J. Zhejiang
provided the original author(s) and source are Univ., 7 (8): 623-626.
credited and that the original publication in this Dominguez J. (2004). State-of-the-art and new
journal is cited, in accordance with accepted perspectives on vermicomposting research,
Earthworm Ecology, C. A. Edwards (Ed.),
academic practice. No use, distribution or
CRC Press LLC, 2004, 401–424.
reproduction is permitted which does not comply
https://doi.org/10.1201/9781420039719.ch20
with these terms. Edwads, C.A. and I. Burrows. (1988). The
potential of earthworms compots as plant
REFERENCES growthmedia in Neuhauser, C. A. (Ed.),
Abou Hussein S. D. and O. M. Sawa. (2010). The Earthworms in Environmetal and Waste
Utilization of Agricultural Waste as One of Mangement. SPB Academic Publishing, The
Bioscience Research, 2020 volume 17(2): 1511-1520 1518Moustafa et al., Physico-chemical and microbial activities of vermicompost
Hague, the Netherlands, pp: 211-220. rehabilitation of tropical soils using compost
Edwards CA, Lofty JR (1972) Biology of and vermicompost is affected by the
earthworms. Chapman and Hall, London. presence of endogeic earth worms. In
Elserafy Z.M., H.A. Sonbol and I.M. Applied Soil Ecology, vol. 46, pp. 125–133.
Eltantawy (1980) The problem of water Kale R Paper presented at the fifth international
hyacinth in rivers and canals, Soil Science symposium on earthworm ecology,
and Plant Nutrition, 26:1, 135-138. Columbus, Ohio, 5–9 July
Ghosh, B.C. ; Bera, N.; Das, D. and Swain, D.K. 1994. Earthworms: nature's gift for utilization
(2013). Effect of varying soil and of organic wastes 1998.
vermicompost mixtures on growing media Kale RD (1995) Vermicomposting has a bright
and yield and quality of sweet corn. In scope. Indian Silk 34:6–9.
International Conference on Food and Kaushik P, Garg VK (2004) Dynamics of biological
Agricultural Sciences, vol. 55, pp. 38–42. and chemical parameters during
Grappelli, A.; E. Galli and U. Tomati. (1987). vermicomposting of solid textile mill sludge
Earthworm casting effect on Agaricus mixed with cow dung and agricultural
bisporus fructification. Agrochimica, 21: 457- residues. BioresTechnol 94:203–209
462. Lin, T. P., C. L. Chen, H. C. Fu, C. Y. Wu, G. H.
Gutiérrez-Miceli, F.A.; Santiago-Borraz, J.; Molina, Lin, S. H. Huang, L. K. Chang and S. T. Liu
J.A.M.; Nafatae, C.C. ; Abud-Archila, M. ; (2005). "Functional analysis of fengycin
Llaven, M.A.O. ; Rosales, R.R. and synthetase FenD." Biochimica Et Biophysica
Dendooven, L. (2007). Vermicompost as a Acta-Gene Structure and Expression
soil supplement to improve growth, yield and 1730(2): 159-164.
fruit quality of tomato (Lycopersicum Muscolo A, Bavolo F, Gionfriddo F, Nardi S (1999)
esculentum). In Bioresource Technology, vol. Earthworm humic matter produces auxins-
98, no. 15, pp. 2781–2786. like effect on DaucusCarota cell growth and
Hasan, M. R. andChakrabarti, R., (2009). Floating nitrate metabolism. Soil
aquatic macrophytes: water hyacinths. In: BiolBiochem31:1303–13.
Hasan, M. R.; Chakrabarty, R. (Eds). Use of Ndegwa P.M. and S.A.Thompson. (2001)
algae and aquatic macrophytes as feed in Integrating composting and vermicomposting
small scale aquaculture - a review.FAO in the treatment of bio-conversion of bio-
Fisheries and Aquaculture Technical solids. Bioresour Technol 76:107–111.
Paper.No. 531. Rome, FAO. 2009. 123p. Orozco, S.H., J. Cegarra, L.M. Trujillo and A.
Heuzé V., Tran G., Hassoun P., Régnier Roig. (1996).Vermicomposting of coffee pulp
C., Bastianelli D., Lebas F., (2015). Water using the earthworms Eisenia Fetida : Effects
hyacinth (Eichhorniacrassipes).Feedipedia, a on C and Ncontent and the avaibility of
programme by INRA, CIRAD, AFZ and nutrients. Biol. Fertil. Soils. 22:162-166.
FAO. https://www.feedipedia.org/node/160 L Rahman A.; M. Jafarpour; E. Kazem and M.
ast updated on October 13, 2015, 16:25 Pessarakli. (2017). Effects of raw materials
Jackson, M.L. (1973). Soil chemical analysis. on vermicompost quality. Journal of Plant
Prentice- Hall Inc. N.J. ,U.D.A. Nutrition 40(11):…..-…..
Jeyabal, A. and Kuppuswamy, G. (2001) Reddy K. R. and W. F. DeBusk. (1985). Growth
Recycling of organic wastes for the characteristics of aquatic macrophytes
production of vermicompost and its response cultured in nutrient-enriched water: II. Azolla,
in rice–legume cropping system and soil Duckweed, and Salvinia.Economic
fertility. In European Journal of Agronomy, Botany,39,(2), pp 200–208.
vol. 15, pp. 153–170. Rupani, P.F.; Ibrahim, M.H. and Ismail, S.A.
Joshi T. N.; D. B., Nepali; R.A .SahandT. C., (2013).Vermicomposting biotechnology:
Bhattarai. (2015).Survivability and recycling of palm oil mill wastes into valuable
multiplication of earthworm species products. Int J Recycl Org Waste
(Eiseniafetida :Oligochaeta, Savigny) during Agricult 2, 10 (2013).
poultry waste disposal, International Sartaj A. B.; J. Singhb and A. P. Viga. (2016).
Invention Journal of Agricultural and Soil Effect on Growth of Earthworm and Chemical
Science, 3(3), 43–46. Parameters during Vermicomposting of
Jouquet, P.; Plumere, T. ; Thu, T.D.; Rumpel, C.; Pressmud Sludge Mixed with Cattle Dung
Duc, T.T. and Orange, D. (2010). The Mixture. Procedia Environmental Sciences
Bioscience Research, 2020 volume 17(2): 1511-1520 1519Moustafa et al., Physico-chemical and microbial activities of vermicompost
35(2016)pp: 425 – 434. rice production. Field Crops (214), 273-282.
Satchell JE (1983) Earthworm microbiology. In:
Satchell JE (ed) Earthworm ecology: from
Darwin to vermiculture. Chapman and Hall,
London, pp 351–365.
Shankar, K.S.; Sumathi, S.; Shankar, M. and
Usharani, K. (2009). Effect of organic farming
on nutritional profile, quality characteristics
and toxic parameters of spinach crop. In
Indian Journal of Dryland Agricultural
Research and Development, vol. 24, no. 2
pp. 66–73
Sinha, R.K.; Hahn, G. ; Singh, P.K.; Suhane, R.K.
and Anthonyreddy, A. (2011). Organic
farming by vermiculture: Producing safe,
nutritive and protective foods by earthworms
(Charles Darwin’s Friends of Farmers). In
American Journal of Experimental
Agriculture, vol. 1, no. 4, pp. 363–399.
Suthar S (2007) Vermicomposting potential
of Perionyx sansibaricus (perrier) in different
waste materials. Bioresour Technol 98:1231–
1237.
Suzuki, M. T., L. T. Taylor and E. F. DeLong
(2000). "Quantitative analysis of small-
subunit rRNA genes in mixed microbial
populations via 5 '-nuclease assays." Applied
and Environmental Microbiology 66(11):
4605-4614.
Tajbakhsh J., Goltapeh E.M., Varma A. (2011)
Vermicompost as a Biological Soil
Amendment. In: Karaca A. (eds) Biology of
Earthworms. Soil Biology, vol 24.Springer,
Berlin, Heidelberg.
Tomati, U.; A. Grappelli and E. Galli. (1988). The
hormone like effect of earthworm casts on
plant growth. Biol. Fertil. Soils. 5: 288-294.
Tucker P (2005) Co-composting paper mill
sludges with fruit and vegetable wastes.
University of Paisley, Paisley.
Walkely, A. and Black, I.A. (1934).An examination
of the degtjareff method for determining soil
organic matter, and a proposed modification
of the chromic acid titration method. Soil Sci.,
37: 29-38.
Yang Huazhu; Fang Yingxue; Chen
Zhonglin.(2001). Integrated farming systems.
In: Integrated agriculture-aquaculture: a
primer. FAO Fisheries Technical Paper, No.
407. FAO, Rome, Italy
Yuanlin Y. Min Zhang, YuhuaTian, Miao
Zhao, Bowen Zhang, Meng
Zhao, KeZeng, Bin Yin. (2017). Duckweed
(Spirodelapolyrhiza) as green cow dung for
increasing yield and reducing nitrogen loss in
Bioscience Research, 2020 volume 17(2): 1511-1520 1520You can also read
