Impaired synthesis and secretion of SopA inSalmonella Typhimurium dam mutants
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
RESEARCH LETTER
Impaired synthesis and secretion of SopA in Salmonella
Typhimurium dam mutants
Mónica N. Giacomodonato1, Sebastián H. Sarnacki1, Mariángeles Noto Llana1, Alejandra S. Garcı́a
Cattaneo1, Sergio Uzzau2, Salvatore Rubino2 & Marı́a Cristina Cerquetti1
1
CEFYBO-CONICET, Departamento de Microbiologı́a, Parasitologı́a e Inmunologı́a, Facultad de Medicina, Universidad de Buenos Aires, Buenos Aires,
Argentina; and 2Dipartimento di Scienze Biomediche, Università di Sassari, Sassari, Italia
Correspondence: Mónica N. Abstract
Giacomodonato, CEFYBO-CONICET,
Departamento de Microbiologı́a,
DNA adenine methylation regulates virulence gene expression in certain bacteria,
Parasitologı́a e Inmunologı́a, Facultad de including Salmonella Typhimurium. The aim of this study was to investigate the
Medicina, Universidad de Buenos Aires, involvement of DNA adenine methylase (Dam) methylation in the expression and
Buenos Aires, Argentina. Tel.: 154 11 5950 secretion of the SPI-1 effector protein SopA. For this purpose, SopA–FLAG-tagged
9500; fax: 154 11 4964 2554; e-mail: wild-type and dam strains of Salmonella Typhimurium were constructed. The
monicagiaco@gmail.com expression and secretion of SopA were determined in bacterial culture and in
intracellular bacteria recovered from infected HEp-2 epithelial cells. Bacterial
Received 25 September 2008; accepted 4
culture supernatants and pellets were used to investigate secreted proteins and
December 2008.
First published online 14 January 2009.
cell-associated proteins, respectively. Western blot and quantitative reverse tran-
scriptase PCR analysis showed that the dam mutant expresses lower levels of SopA
DOI:10.1111/j.1574-6968.2008.01473.x than the wild-type strain. Interestingly, the strain lacking Dam synthesizes SopA
under nonpermissive conditions (28 1C). In addition, SopA secretion was drasti-
Editor: Reggie Lo cally impaired in the dam mutant. In vivo experiments showed that the intracel-
lular Salmonella dam mutant synthesizes SopA although in lower amounts than
Keywords the wild-type strain. Taken together, our results suggest that Dam methylation
Salmonella Typhimurium; SopA; DNA adenine modulates the expression and secretion of SopA in Salmonella Typhimurium.
methylase (Dam).
number of genes that are normally only produced in vivo
Introduction during the initiation and progression of bacterial infection
Alteration of DNA adenine methylase (Dam) activity has (Heithoff et al., 1999, 2001; Mahan et al., 2000); addition-
been shown to attenuate the virulence of several pathogens ally, both bacteria-associated and secreted proteins are
and to confer protective immune responses in vaccinated affected by the loss of Dam regulation (Garcı́a del Portillo
animals (Wion & Casadesús, 2006). The molecular basis of et al., 1999; Heithoff et al., 2001; Pucciarelli et al., 2002). A
virulence attenuation and protection conferred in dam recent report by Balbontı́n et al. (2006) provided evidence
mutant strains appears to involve ectopic gene expression that Dam methylation regulates the invasion genes of the
and the resultant elaboration of an expanded repertoire of pathogenicity island 1 (SPI-1); they proposed a correlation
antigens. Additionally, the low-grade persistence of dam between specific alterations of gene expression and certain
mutant vaccines in appropriate lymphoid tissues (e.g. virulence defects of Salmonella dam mutants. The need for
Peyer’s patches) in Salmonella spp. (Garcı́a del Portillo Dam methylation to activate the expression of SPI-1 genes
et al., 1999; Heithoff et al., 2001) and in Yersinia (Julio seems to provide a straightforward explanation for the
et al., 2001) may provide a stable source of antigens in reduced secretion of SPI-1 effectors such as SipA, SipB and
sufficient quantity and duration for the transition toward SipC reported earlier (Garcı́a del Portillo et al., 1999).
the development of potent adaptive immune responses Certain effector proteins, such as SopA, whose secretion is
(Dueger et al., 2001; Heusipp et al., 2007). This suggestion mediated by the SPI-1 type III secretion system (TTSS-1),
is supported by work with Salmonella wherein loss of the are encoded by genes that are located outside SPI-1. SopA
Dam function results in a number of changes in the bacterial participates in triggering inflammation through its E3 ligase
physiology. Dam mutants appear to express in vitro a activity (Zhang et al., 2006) and facilitates the bacterial
FEMS Microbiol Lett 292 (2009) 71–77
c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved72 M.N. Giacomodonato et al.
escape out of the Salmonella-containing vacuoles into the pellets were resuspended in 100 mL of H2O and immediately
cytosol (Zhang et al., 2005). In this work, we found that mixed with 100 mL of Laemmli lysis buffer (Laemmli, 1970).
Dam methylation regulates the expression and secretion of Suspensions were incubated at 100 1C for 5–10 min. For the
SopA effector protein. These findings would contribute isolation of proteins released into the culture supernatants
towards the understanding of attenuation of bacteria lacking (secreted proteins), cells were pelleted by centrifugation and
the Dam protein, proposed as live vaccines. 2-mL supernatant was collected from each sample. The
supernatants were then filtered (0.45-mm pore size), and
Materials and methods the proteins were precipitated with 25% TCA and sedimen-
ted by high-speed centrifugation (14 000 g for 30 min). The
Bacterial strains pellet was washed in cold acetone and resuspended in
phosphate-buffered saline (PBS) and Laemmli buffer. Four
Salmonella Typhimurium American Type Culture Collec-
independent extractions for each sample were added to-
tion (ATCC) 14028 and derived strains tagged with the 8-aa
gether to minimize differences in protein recovery from
FLAG epitope tag peptide were used in this work. Strain
sample to sample. The proteins were then boiled for
SSM2795 (sopA::3 FLAG) was obtained using the method
5–10 min, and an aliquot of each sample was separated by
described by Uzzau et al. (2001). 3 FLAG epitope tails
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
were added to the ends of the sopA gene. The 3 FLAG
(10% gel) (Raffatellu et al., 2005).
epitope is a sequence of three tandem FLAG epitopes
(22 aa). A pair of primers was designed to amplify a
3 FLAG and kanR coding sequence using plasmid pSUB11 Immunodetection analysis
(Uzzau et al., 2001). The 3 0 ends of these oligonucleotides 3 FLAG fusion SopA was immunodetected using mouse
were complementary to the first 20 nt of the pSUB11 anti-FLAG M2-peroxidase mAbs (Sigma). SopA expression
3 FLAG coding region (GACTACAAAGACCATGACGG, and secretion were normalized to 106 CFU and shown as
forward primers) and to the 20 nt of the pSUB11 priming arbitrary units. Detection was performed by chemilumines-
site 2 (CATATGAATATCCTCCTTAG, reverse primers). The cence (Luminol, Santa Cruz Biotechnology). Blots were
5 0 -ends of the oligonucleotides were designed to be homo- scanned, and the intensity of the signals was determined
logous to the last 40 nt of each tagged gene, not including using the public domain NIH IMAGE program (http://rsb.in
the stop codon (forward primers), and to the 40 nt immedi- fo.nih.gov/nih-image/).
ately downstream of the gene stop codon (reverse primers).
The high-frequency generalized transducing bacteriophage Quantitative reverse transcriptase PCR (qRT-PCR)
P22HT was used for the transduction. The Ddam-230 zge-
6313::Tn10dCmR allele was transduced from the Salmonella Total bacterial RNA was extracted using Trizol reagent (Life
Typhimurium SV4712 strain (kindly provided by Dr Casa- Technologies Inc., Grand Island, NY). Total RNA (1 mg per
desús) into the tagged strains SSM2795, resulting in a dam sample) was reverse-transcribed using Transcriptor Reverse
strain called STD2795 (sopA::3 FLAG Ddam-230 zge- Transcriptase (Roche, Basel, Switzerland) according to the
6313::Tn10dCmR). Complementation assays were per- manufacturer’s protocol. qRT-PCR was performed using the
formed using plasmid pIZ833 – a pMM40 derivative carry- SYBR Green PCR kit (PE Applied Biosystems, Foster City,
ing the dam gene of Salmonella Typhimurium strain SL1344 CA) using an Applied Biosystems 7700 sequence detector.
under the control of a tac promoter (A.I. Prieto, unpub- Measured mRNA levels were normalized to the mRNA
lished data). levels of the 16S rRNA gene. The primer sequences
were SopA forward, TCCACCGTGAAGTTGATTGA, and
Preparation of secreted proteins reverse, GCACTGAGGATGTGCTGGTA, and 16S forward,
TGTAGCGGTGAAATGCGTAG, and reverse, CAAGGGCA-
Bacterial strains were grown under conditions that either CAACCTCCAAG. Cycling conditions were 95 1C for
induce or not the expression of SPI-1 genes, as described by 10 min, followed by 45 cycles of 95 1C for 10 s, 55 1C for
Miki et al. (2004). Bacterial culture supernatants and pellets 10 s and 72 1C for 15 s and one cycle of 40 1C for 30 s.
were obtained to investigate secreted proteins and cell-
associated proteins, respectively (Pucciarelli et al., 2002).
Ileal loops
Bacteria were grown overnight, in Luria–Bertani (LB) broth
containing 0.3 M NaCl, without aeration, at 37 1C (SPI-1- Six- to eight-week-old BALB/c mice were purchased from
inducing conditions) or at 28 1C (noninducing conditions). the Facultad de Ciencias Exactas y Naturales, Universidad de
For the isolation of cell-associated proteins, bacterial strains Buenos Aires, and kept in our animal house throughout the
carrying the epitope-tagged gene were grown in 1.5-mL experiments. All experiments were performed in accordance
cultures to the stationary phase and centrifuged. Bacterial with the guidelines of the School of Medicine Animal Care
c 2009 Federation of European Microbiological Societies FEMS Microbiol Lett 292 (2009) 71–77
Published by Blackwell Publishing Ltd. All rights reservedSopA in Salmonella dam mutants 73
and Use Committee. The model described by Jones et al. Table 1. Invasion and proliferation of tagged strains
(1994) was used to study the invasion capacity of ATCC Control wtw dam dam/pIZ
14028, SSM2795, STD2795 and STD2795/pIZ833 strains of z
Ileal loop invasion (%) 100 97 45‰ 46‰
Salmonella Typhimurium. Mice were infected intraloop HEp-2 invasion (%)z 100 103 40‰ ND
with 107 CFU of each bacterial strain and sacrificed HEp-2 intracellular 100 96 60‰ 100
60 min later. Ileal loops were aseptically removed and proliferation (%)z
incubated for 60 min in gentamicin before homogenizing. Wild-type untagged strain, Salmonella Typhimurium ATCC 14028.
Intracellular bacteria were recovered by plating homogenate w
Wild-type tagged strain, Salmonella Typhimurium SSM2795.
dilutions. ‰
P o 0.05 with respect to the wild-type tagged strain of Salmonella
Typhimurium SSM2795.
z
Bacterial infection of eukaryotic cells Expressed as percentage with respect to control strain Salmonella
Typhimurium ATCC 14028.
Human laryngeal epithelial (HEp-2) cells (ATCC, CCL-23) Ileal loop invasion was assessed 60 min after infection in BALB/c mice.
were maintained in DMEM containing 10% fetal bovine HEp-2 cells were used to investigate Salmonella Typhimurium invasion
serum. Confluent monolayers were inoculated with bacteria and proliferation at 20 min and 24 h, respectively.
grown standing overnight in LB broth, at a multiplicity of ND, not determined.
infection of 10 : 1. Infected monolayers were then incubated
for 20 min at 37 1C in 5% CO2, washed twice with PBS and
then incubated in fresh tissue culture medium containing
both methylated and unmethylated DNA, but only DNA
100 mg mL1 gentamicin for 30 min to remove extracellular
from the dam mutant was cut with MboI, which requires
bacteria. Finally, monolayers were washed three times with
unmethylated adenine residues; wild-type DNA was cleaved
PBS and lysed with 1% Triton X-100 in PBS to release
with DpnI, which digests methylated adenine residues. The
intracellular bacteria. An aliquot of this suspension was used
digestion pattern was restored to that of the wild type in the
to determine the number of intracellular bacteria by plating
dam mutant complemented with pIZ833 plasmid, indicat-
serial dilutions onto LB agar plates. Released bacteria were
ing that the differences observed between dam and wild-type
then prepared for immunoblotting analysis as described
methylation patterns are due to lack of the Dam protein
above. In selected experiments, intracellular CFU were
(data not shown). In line with previous studies on Salmo-
counted both 20 min and 24 h after infection to determine
nella dam mutants (Garcı́a del Portillo et al., 1999), we
the replication rate of intracellular Salmonella. Invasion
found that tagged strain STD2795 (sopA::3 FLAG Ddam-
rates of nonphagocytic cells were determined as the ratio of
230 zge-6313::Tn10dCmR) shows defects in invasion within
viable intracellular bacteria recovered shortly after infection
nonphagocytic cells (Table 1). Invasiveness was investigated
(20 min) vs. viable bacteria added to infect the eukaryotic
using both HEp-2 cultured cells and the murine ileal loop;
cells.
the results are presented in Table 1. Salmonella dam strain
was partially impaired for invading nonphagocytic cells
Results and discussion (45% of wild-type values in cultured cell and 40% of wild-
type values in murine ileal mucosa). A significant defect in
Epitope tagging does not modify wild-type or
the proliferation of the dam strain within HEp-2 cells was
dam phenotypes also detected (60% of wild-type values). The DNA methyla-
In order to investigate whether tagging of SopA with the tion pattern and proliferation capacity of the mutant were
FLAG epitope affects virulence properties, we performed restored by introducing the dam gene cloned in plasmid
experiments using tagged and untagged wild-type Salmo- pIZ833. The invasion defect of the dam mutant, however,
nella Typhimurium. No significant differences in invasive- could not be fully restored by complementation (Table 1).
ness or intracellular proliferation were observed in any of the Failure in restoring certain virulence traits after comple-
wild-type strains studied (Table 1). These findings are in mentation of dam mutants has been reported earlier
agreement with an earlier work performed in a murine (Garcı́a del Portillo et al., 1999; Heithoff et al., 2001;
model of infection (Giacomodonato et al., 2007). It has Balbontı́n et al., 2006) and could be explained by the fact
been well documented that lack of the Dam protein affects that overproduction of Dam methylase reproduces
DNA methylation status, bacterial invasion and intracellular certain phenotypes of mutant strains lacking the Dam
proliferation capacities (Garcı́a del Portillo et al., 1999; protein (Torreblanca & Casadesus, 1996; Løbner-Olesen
Heithoff et al., 2001). Our results show that tagging of the et al., 2005). Altogether, our results show that epitope
SPI-1 gene sopA does not modify the attenuated phenotype tagging does not affect the dam phenotype of Salmonella
of the Salmonella Typhimurium dam mutant. DNA from all mutants; consequently, tagged strains were used in this
the strains tested was cleaved with Sau3AI, which recognizes work.
FEMS Microbiol Lett 292 (2009) 71–77
c2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved74 M.N. Giacomodonato et al.
(a) SPI-1-inducing conditions (37 °C) SPI-1-non-inducing conditions (28 °C)
wt dam dam/pIZ wt dam dam/pIZ
SopA
(b) 250 *
SopA expression (AU)
200
150 * 37 °C
§ # 28 °C
100
50
0
wt dam dam/pIZ
Fig. 1. Analysis of SopA expression in vitro by Western blot. Salmonella Typhimurium-tagged strains SSM2795 (wt), STD2795 (dam) and STD2795/
pIZ833 (dam/pIZ) were grown at 37 1C (SPI-1-inducing conditions) or at 28 1C (noninducing conditions). (a) Bacterial pellets were processed and used to
investigate cell-associated proteins. Samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and tagged proteins were
detected by anti-FLAG antibodies. Each lane was loaded with material from c. 107 CFU. (b) SopA levels in whole-cell bacteria. SopA expression was
normalized to 106 CFU and shown as arbitrary units (AU). Data are mean SD from six different experiments. P o 0.05 between the wild-type strain at
37 1C vs. the wild-type strain at 28 1C; dam/pIZ at 37 1C vs. dam/pIZ at 28 1C; ‰P o 0.05 with respect to the wild-type and dam/pIZ strains at 37 1C,
#
P o 0.001 with respect to the wild-type and dam/pIZ strains at 28 1C (ANOVA).
Dam mutants of Salmonella Typhimurium Table 2. qRT-PCR for sopA expression
synthesize low amounts of SopA Expression levels of sopA gene
We examined the effect of the absence of Dam on SopA SPI-1-inducing SPI-1-non-inducing
synthesis under SPI-1-inducing (37 1C) and noninducing conditions (37 1C) conditions (28 1C)
(28 1C) conditions. The relative amount of the effector wt 1.000 0.002 0.109 0.098
protein present in the whole bacterial extract was quantified. dam 0.412 0.081 0.390 0.143
As expected, SopA was synthesized by wild-type strain dam/pIZ 0.803 0.157 0.273 0.102
grown under SPI-1 conditions (Fig. 1a). Densitometry
Relative mRNA amounts were determined by qRT-PCR and related to
analysis showed a significant reduction of SopA synthesis mRNA levels in wild-type strain grown under inducing conditions, set as
under SPI-1 conditions in the dam mutant compared with 1. Values are means SDs from three independent experiments.
the wild-type strain (P o 0.01) and the complemented Significance of difference (P o 0.05) from level in wild-type strain
strain (P o 0.05) (Fig. 1b). Compared with the wild-type grown under inducing conditions was calculated by Student’s t-test.
strain, the Salmonella dam mutant expressed (under indu-
cing conditions) only 20% of the amount of SopA. Interest- Dam relaxes the temperature regulation of SopA synthesis.
ingly, the dam mutant expressed SopA under noninducing Our results are in agreement with previous data obtained
conditions (28 1C), whereas no synthesis of the effector was from Yersinia spp., showing that Dam overproduction leads
observed in the wild-type or the complemented strain at this to the expression and secretion of Yop virulence proteins
temperature. Moreover, no significant differences were under nonpermissive conditions (Julio et al., 2001, 2002).
found in the amount of SopA expressed by the dam mutant These authors demonstrated that Dam overproduction
grown at 37 or 28 1C (Fig. 1b). This downregulation of SopA disrupts both thermal and calcium regulation of YopE
expression in dam mutants was confirmed by qRT-PCR in synthesis and relaxes the thermal (but not calcium) depen-
relation to 16S rRNA gene expression. The transcript level of dence of YopE secretion.
sopA was decreased in the dam mutant approximately
twofold (P o 0.05) compared with the wild-type or the
complemented strains under SPI-1-inducing conditions. SopA secretion is impaired in dam mutants of
Again, no differences in the expression of sopA were detected Salmonella Typhimurium
in the dam mutant grown under inducing or noninducing The relative amounts of SopA were assessed in wild-type and
conditions (Table 2). These findings suggest that lack of dam strain culture supernatants. Under conditions that
c 2009 Federation of European Microbiological Societies FEMS Microbiol Lett 292 (2009) 71–77
Published by Blackwell Publishing Ltd. All rights reservedSopA in Salmonella dam mutants 75
(a) SPI-1-inducing conditions (37 °C) SPI-1-non-inducing conditions (28 °C)
Fig. 2. Analysis of SopA secretion in vitro by
Western blot. Salmonella Typhimurium-tagged
wt dam dam/pIZ wt dam dam/pIZ
strains SSM2795 (wt), STD2795 (dam) and SopA
STD2795/pIZ833 (dam/pIZ) were grown at 37 1C
(SPI-1-inducing conditions) or at 28 1C (nonin-
(b) 15 *
ducing conditions). (a) Bacterial supernatants
were processed and used to investigate secreted
SopA secretion (AU)
proteins. Samples were subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophor- 10 37 °C
esis and tagged proteins were detected by anti- 28 °C
FLAG antibodies. Each lane was loaded with
secreted proteins from c. 107 CFU. (b) SopA 5
secretion levels were normalized to 106 CFU and
shown as arbitrary units (AU). Data are
mean SD from six different experiments. 0
P o 0.05 (ANOVA). wt dam dam/pIZ
mimic the intestinal environment (37 1C), only the wild- movement of polymorphonuclear leukocytes across the
type strain secreted SopA (Fig. 2a). Despite the fact that intestinal epithelium. In addition, Zhang et al. (2002)
SopA was expressed in dam cells grown at 37 and 28 1C showed that SopA acts in concert with other TTSS-1
(although in low amount), the protein could not be detected secreted effector proteins. In addition, Layton et al. (2005)
in the supernatants at any temperature. Moreover, SopA have reported that SopA localizes in the mitochondria; the
secretion in the dam mutant was not restored after com- correlation of this fact with the role of SopA in virulence
plementation (Fig. 2a and b). These results are in line with remains unknown.
our previous observation that SopA is the effector protein
secreted in the lowest amount following intragastrical or
intraperitoneal infection of mice with Salmonella Typhi-
Dam methylation triggers SopA synthesis in
murium (Giacomodonato et al., 2007). Lack of SopA
Salmonella Typhimurium intracellular bacteria
secretion in dam mutants could be explained considering We investigated the synthesis of SopA in dam mutants
that Dam methylation is required to activate the expression during early stages of HEp-2 cells infection. Confluent
of certain SPI-1 syringe-encoding genes (Balbontı́n et al., HEp-2 cells were infected with SopA–FLAG-tagged Salmo-
2006). Nevertheless, dam mutants showed not only impair- nella mutants. Intracellular bacteria were collected 20 min
ment in SopA secretion but also a reduced synthesis of this after infection. As shown in Fig. 3a, the epitope-tagged SopA
effector protein. These results are in agreement with those could be detected specifically. Soon after infection, SopA
reported earlier showing that dam mutants of Salmonella appears to be expressed at a lower level in dam mutant
Typhimurium are significantly reduced in their ability to STD2795 compared with wild-type strain SSM2795
synthesize and secrete SipC (Balbontı́n et al. 2006). It would (P o 0.05). Of note, the amount of SopA detected intracel-
be premature, however, to conclude that dam strains are lularly in wild-type and dam strains at 20 min postinfection
totally unable to secret SopA. On the one hand, it is possible (Fig. 3) was fivefold higher than that synthesized by bacteria
that the amount of SopA secreted by dam mutants is below cultured under SPI-1-inducing condition (Fig. 1).
the detection limit of our method. On the other, Zhang et al. Previously, we demonstrated that the expression of SPI-1
(2005) demonstrated that SopA has a short life span. genes persists for several hours after infection of mice
A reduced secretion of the SPI-1 effector proteins such as (Giacomodonato et al., 2007). Then, we investigated
SipA, SipB and SipC in Salmonella dam mutants has been whether SopA is expressed in dam mutants during late
reported earlier (Garcı́a-Del Portillo et al., 1999). More stages of HEp-2 cells infection. For this purpose, HEp-2
recently, Balbontı́n et al. (2006) identified genes that are cells were infected and the intracellular bacteria were col-
up- or downregulated in dam mutants, indicating that Dam lected 24 h after infection. The results are shown in Fig. 4a
methylation represses or activates their expression. There- and b. We found that SopA is expressed in intracellular
fore, our results suggest that the sopA gene is activated by bacteria 24 h after infection. Once again, SopA was synthe-
Dam methylation. In contrast to other Salmonella effector sized at a lower level in the dam mutant compared with the
proteins, such as SopB, SopD and SopE2, relatively little is wild-type strain (P o 0.05) (Fig. 4a and b). This finding
known about SopA. An earlier work by Wood et al. (2000) suggests a sustained expression of these effectors after
demonstrated a role for SopA in the Salmonella-induced invasion. Therefore, it would be important to carefully
FEMS Microbiol Lett 292 (2009) 71–77
c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved76 M.N. Giacomodonato et al.
(a) wt dam dam/pIZ Acknowledgements
SopA We are very grateful to Ms Marı́a Isabel Bernal for her
excellent technical assistance and to Dr J. Casadesús for
(b) 1200 providing the SV4712 strain. This work was supported in
part by grants from Agencia Nacional de Promoción a la
SopA expression (AU)
1000
Ciencia y Tecnologı́a (PICT – 2006-00407) and from Uni-
800 versidad de Buenos Aires (UBACyT M608 and M009),
600 Argentina.
*
400
200
References
0
wt dam dam/pIZ Balbontı́n R, Rowley G, Pucciarelli MG, López-Garrido J,
Wormstone Y, Lucchini S, Garcı́a-Del Portillo F, Hinton JC &
Fig. 3. Analysis of SopA expression in intracellular bacteria at 20 min Casadesús J (2006) DNA adenine methylation regulates
postinfection. HEp-2 cells were infected with Salmonella Typhimurium- virulence gene expression in Salmonella enterica serovar
tagged strains, SSM2795 (wt), STD2795 (dam) and STD2795/pIZ833
Typhimurium. J Bacteriol 188: 8160–8168.
(dam/pIZ) for 20 min. (a) Western blot. Each lane was loaded with
Coburn B, Li Y, Owen D, Vallance BA & Finlay BB (2005)
material from c. 105 CFU. (b) SopA levels in intracellular bacteria. SopA
Salmonella enterica serovar Typhimurium pathogenicity island
expression was normalized to 106 CFU and shown as arbitrary units (AU).
Data are mean SD from three different experiments. P o 0.05 with 2 is necessary for complete virulence in a mouse model of
respect to the wild-type and the complemented strain. infectious enterocolitis. Infect Immun 73: 3219–3227.
Dueger EL, House JK, Heithoff DM & Mahan MJ (2001)
(a) wt dam dam/pIZ Salmonella DNA adenine methylase mutants elicit protective
immune responses to homologous and heterologous serovars
SopA
in chickens. Infect Immun 69: 7950–7954.
Garcı́a-Del Portillo F, Pucciarelli MG & Casadesus J (1999) DNA
(b) 250 adenine methylase mutants of Salmonella typhimurium show
SopA expression (AU)
defects in protein secretion, cell invasion, and M cell
200
cytotoxicity. Proc Natl Acad Sci USA 96: 11578–11583.
150 *
Giacomodonato MN, Uzzau S, Bacciu D, Caccuri R, Sarnacki S,
Rubino S & Cerquetti MC (2007) SipA, SopA, SopB, SopD and
100 SopE2 effector proteins of Salmonella enterica serovar
50 Typhimurium are synthesized at late stages of infection in
mice. Microbiol 153: 1221–1228.
0 Heithoff DM, Sinsheimer RL, Low DA & Mahan MJ (1999) An
wt dam dam/pIZ essential role for DNA adenine methylation in bacterial
Fig. 4. Analysis of SopA expression in intracellular bacteria at 24 h virulence. Science 284: 967–970.
postinfection. HEp-2 cells were infected with Salmonella Typhimurium- Heithoff DM, Enioutina EY, Daynes RA, Sinsheimer RL, Low DA
tagged strains, SSM2795 (wt), STD2795 (dam) and STD2795/pIZ833 & Mahan MJ (2001) Salmonella DNA adenine methylase
(dam/pIZ) for 24 h. (a) Western blot. Each lane was loaded with material mutants confer cross-protective immunity. Infect Immun 69:
from c. 107 CFU. (b) SopA levels in intracellular bacteria. SopA expression 6725–6730.
was normalized to 106 CFU and shown as arbitrary units (AU). Data are Heusipp G, Fälker S & Schmidt MA (2007) DNA adenine
mean SD from three different experiments. P o 0.05 with respect to
methylation and bacterial pathogenesis. Int J Med Microbiol
the wt strain.
297: 1–7.
Jones BD, Ghori N & Falkow S (1994) Salmonella typhimurium
initiates murine infection by penetrating and destroying the
consider the dichotomous roles of SPI-1 and SPI-2 in the
specialized epithelial M cells of the Peyer’s patches. J Exp Med
intestinal and/or the systemic paradigm of Salmonella infec- 180: 15–23.
tion (Coburn et al., 2005; Schlumberger & Hardt, 2006). Julio SM, Heithoff DM, Provenzano D, Klose KE, Sinsheimer RL,
In summary, we found that in vitro and in vivo expression Low DA & Mahan MJ (2001) DNA adenine methylase is
of SopA is impaired in dam mutants of Salmonella Typhi- essential for viability and plays a role in the pathogenesis of
murium; moreover, no secreted SopA could be detected. Yersinia pseudotuberculosis and Vibrio cholerae. Infect Immun
Altered expression and/or secretion of proteins in dam 69: 7610–7615.
strains may contribute to the decreased virulence and Julio SM, Heithoff DM, Sinsheimer RL, Low DA & Mahan MJ
heightened immunity observed in vaccinated hosts. (2002) DNA adenine methylase overproduction in Yersinia
c 2009 Federation of European Microbiological Societies FEMS Microbiol Lett 292 (2009) 71–77
Published by Blackwell Publishing Ltd. All rights reservedSopA in Salmonella dam mutants 77
pseudotuberculosis alters YopE expression and secretion and Schlumberger MC & Hardt WD (2006) Salmonella type III
host immune responses to infection. Infect Immun 70: secretion effectors: pulling the host cell’s strings. Curr Opin
1006–1009. Microbiol 9: 1–9.
Laemmli UK (1970) Cleavage of structural proteins during the Torreblanca J & Casadesus J (1996) DNA adenine methylase
assembly of the head of bacteriophage T4. Nature 227: mutants of Salmonella typhimurium and a novel Dam-
regulated locus. Genetics 144: 15–26.
680–685.
Uzzau S, Figueroa-Bossi N, Rubino S & Bossi L (2001) Epitope
Layton AN, Brown PJ, Edouard E & Galyov EE (2005) The
tagging of chromosomal genes in Salmonella. Proc Natl Acad
Salmonella Translocated Effector SopA is targeted to the
Sci USA 26: 15264–15269.
mitochondria of infected cells. J Bacteriol 187: 3565–3571.
Wion D & Casadesús J (2006) N6-methyl-adenine: an epigenetic
Løbner-Olesen A, Skovgaard O & Marinus MG (2005) Dam
signal for DNA-protein interactions. Nat Rev Microbiol 43:
methylation: coordinating cellular processes. Curr Opin 183–192.
Microbiol 8: 154–160. Wood MW, Jones MA, Watson PR, Siber AM, McCormick BA,
Mahan MJ, Heithoff DM, Sinsheimer RL & Low DA (2000) Hedges S, Rosqvist R, Wallis TS & Galyov EE (2000) The
Assessment of bacterial pathogenesis by analysis of secreted effector protein of Salmonella dublin, SopA, is
gene expression in the host. Annu Rev Genet 34: translocated into eukaryotic cells and influences the induction
139–164. of enteritis. Cell Microbiol 2: 293–303.
Miki T, Okada N & Danbara H (2004) Two periplasmic disulfide Zhang S, Santos SRL, Tsolis RM, Stender S, Hardt W-D, Baümler
oxidoreductases, DsbA & SrgA, target outer membrane AJ & Adams LG (2002) The Salmonella enterica serotype
protein SpiA, a component of the Salmonella pathogenicity Typhimurium effector proteins SipA, SopA, SopB, SopD, and
SopE2 act in concert to induce diarrhea in calves. Infect Immun
isl& 2 type III secretion system. J Biol Chem 279: 34631–34642.
70: 3843–3855.
Pucciarelli MG, Prieto AI, Casadesus J & Garcı́a-del Portillo F
Zhang Y, Higashide W, Dai S, Sherman DM & Zhou D (2005)
(2002) Envelope instability in DNA adenine methylase
Recognition and ubiquitination of Salmonella type III effector
mutants of Salmonella enterica. Microbiol 148: 1171–1182.
SopA by an ubiquitin E3 ligase, HsRMA1. J Biol Chem 280:
Raffatellu M, Wilson RP, Chessa D, Andrews-Polymenis H, Tran
38682–38688.
QT, Lawhon S, Khare S, Adams LG & Bäumler AJ (2005) SipA, Zhang Y, Higashide WM, McCormick BA, Chen J & Zhou D
SopA, SopB, SopD, & SopE2 contribute to Salmonella enterica (2006) The inflammation-associated Salmonella SopA
serotype typhimurium invasion of epithelial cells. Infect is a HECT-like E3 ubiquitin ligase. Mol Microbiol 62:
Immun 73: 146–154. 786–793.
FEMS Microbiol Lett 292 (2009) 71–77
c 2009 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reservedYou can also read
