PURIFICATION OF AN OLIGO(DG). OLIGO(DC)-BINDING SEA URCHIN NUCLEAR PROTEIN, SUGF1: A FAMILY OF G-STRING FACTORS INVOLVED IN GENE REGULATION DURING ...
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, Feb. 1994, p. 1402-1409 Vol. 14, No. 2
0270-7306/94/$04.00+0
Copyright X 1994, American Society for Microbiology
Purification of an Oligo(dG). Oligo(dC)-Binding Sea Urchin
Nuclear Protein, suGF1: a Family of G-String Factors
Involved in Gene Regulation during Development
JANET HAPGOOD* AND DANIELLE PAT'ITERTONt
Research Centre for Molecular Biology, Department of Biochemistry,
University of Cape Town, Rondebosch 7700, South Africa
Received 7 June 1993/Returned for modification 24 August 1993/Accepted 15 November 1993
Contiguous deoxyguanosine residues (G strings) have been implicated in regulation of gene expression in
several organisms via the binding of G-string factors. Regulation of expression of the chicken adult 13-globin
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
gene may involve the interplay between binding of an erythrocyte-specific G-string factor, BGP1, and the
stability of a positioned nucleosome (C. D. Lewis, S. P. Clark, G. Felsenfeld, and H. Gould, Genes Dev.
2:863-873, 1988). We have purified a 59.5-kDa nuclear protein (suGF1) from sea urchin embryos by DNA
affinity chromatography. suGF1 has high binding affinity and specificity for oligo(dG) oligo(dC). The identity
-
of the purified protein was confirmed by renaturation of sequence-specific DNA-binding activity from a sodium
dodecyl sulfate-polyacrylamide gel slice and by Southwestern (DNA-protein) blotting. suGF1 binds in vitro to
a G,, string present in the H1-H4 intergenic region of a sea urchin early histone gene battery. This suGFl DNA
recoguition site occurs within a homopurine-homopyrimidine stretch previously shown to be incorporated into
a positioned nucleosome core in vitro. DNase I footprinting shows that suGF1 protects the same base pairs on
the promoter of the chicken PA-globin gene as does BGP1. We show that a G-string cis-regulatory element of
a sea urchin cell lineage-specific gene LpS1 (M. Xiang, S.-Y. Lu, M. Musso, G. Karsenty, and W. H. Klein,
Development 113:1345-1355, 1991) also represents a high-affinity recognition site for suGFl. suGFl may be a
member of a family of G-string factors involved in the regulation of expression of unrelated genes during
development of a number of different organisms.
G strings of 10 bp and longer are frequently found in the structures such as triple helices in vitro, the formation of
noncoding regions of unrelated genes (4, 19). In addition, which depends critically on the degree of superhelical stress
G-string-binding factors have been detected in a number of of the DNA, the length of the homopurine stretch, and the
different tissues from various organisms (8, 19, 22, 38). The chemical environment (21, 36). Several authors have pro-
promoter of the chicken adult 3-globin gene contains a G posed that G strings may function in vivo as a conforma-
string of 16 to 18 Gs (22, 28). There is strong evidence that tional switch which is modulated in some way by G-string-
regulation of expression of this gene involves a complex binding proteins (4, 19, 20, 24).
interplay between binding of a G-string factor, DNA confor- A similar role has been proposed for G-rich regions which
mation, and displacement of a positioned nucleosome at the occur within pur. pyr stretches upstream of several house-
G string (22). A G6 string has also been implicated in keeping genes such as the c-Ki-ras, epidermal growth factor
regulation of gene expression during sea urchin development receptor, and c-myc genes (6, 12, 14, 23, 29). These pur- pyr
via binding of a G-string factor to a cis-regulatory element regions are S1 nuclease sensitive in vitro and bind to factors
present in the promoter of a cell lineage-specific gene LpS13 containing multiple copies of the sequence GGGNGGG in
(38). This sea urchin G-string factor may be related to a their DNA recognition sites. In some cases, alterations in
putative mammalian transcription factor, IF1, implicated in chromatin structure correlating with the state of expression
the coordinate regulation of expression of the (xl (I) and a2 of these genes have been mapped to the pur. pyr regions in
(I) collagen genes during embryonic development via binding nuclei.
to G7 strings present in both promoters (17, 38). Interest- These observations raise several unresolved issues. G
ingly, a G7 string occurs within a purine-rich region of the strings may play a role in gene regulation during develop-
chicken ct2(I) collagen gene promoter which is hypersensi- ment via families of G-string factors with related functions.
tive to Si nuclease and DNase I in chromatin in a tissue- The structural and functional relationships among various
specific fashion (24). G-string factors as well as factors binding to G-rich se-
G strings have in common with homopurine-homopyrimi- quences within pur- pyr stretches need to be examined,
dine (pur. pyr) stretches the ability to form unusual DNA
considering the parallels that can be drawn between their
proposed biological roles and the similarities in their DNA
recognition sites. The biological significance of unusual
*
Corresponding author. Present address: Regulatory Peptides DNA structures, their possible interaction with G-string and
Research Unit, Department of Chemical Pathology, Medical G-rich factors, and the dependency of this putative interac-
School, University of Cape Town, Observatory 7925, South Africa. tion on the length of the polypurine tract need to be
Phone: (021) 406 6354. Fax: (021) 406 6153. Electronic mail address:
JANET@chempath.uct.ac.za. investigated. It is possible that the generation of nuclease-
t Present address: Laboratory of Molecular Embryology, Na- hypersensitive sites at pur. pyr stretches of developmen-
tional Institute of Child Health and Human Development, National tally regulated genes is a shared function of a family of
Institutes of Health, Bethesda, MD 20892. G-string factors and may involve the stability of positioned
1402VOL. 14, 1994 G-STRING FACTORS IN DEVELOPMENTAL GENE REGULATION 1403
nucleosomes (32). Purification of G-string factors and a 0.2 mM EDTA-0.2 mM EGTA (ethylene glycol-bis(,B-ami-
detailed analysis of their interaction with DNA and chroma- noethyl ether)-N,N,N',N'-tetraacetic acid)-10 mM 1-mer-
tin should enable some of these questions to be addressed captoethanol-0.1 mM phenylmethylsulfonyl fluoride. The
experimentally. suspension was rolled for 2 h to allow swelling of the cell
As a first step towards this goal, we have focused our membranes. The 4-h embryos were pushed twice through
attention on an early histone gene battery of the sea urchin two layers of 50-pm-pore-size nylon mesh, whereas later-
Psammechinus milians. A G1I string is present in the H1-H4 stage embryos were homogenized with 15 strokes of a tight
intergenic region of this developmentally regulated, coordi- Dounce homogenizer. Crude nuclei were pelleted by centrif-
nately expressed gene battery (11). Nuclease-hypersensitive ugation (4,000 x g, 1 min) and washed once with Hex-A
regions are present in the intergenic spacers when the genes buffer. The pellet was resuspended in a minimum-volume
are expressed, while the shutdown of expression correlates Hex-A buffer and made up to 1.8 M sucrose by adding the
with the presence of well defined spaced nucleosomes (37). required volume of 2.3 M sucrose in buffer A. The homoge-
A nucleosome has been shown to be positioned in vitro on neous suspension was centrifuged at 30,000 x g for 45 min.
the H1-H4 intergenic region of the P. miliaris gene battery Nuclei were washed once with Hex-A buffer and processed
(27, 30). Within the positioning sequences lies the unusual immediately for nuclear extracts by ammonium sulfate ex-
sequence (GA)16(G)11, which forms an unusual DNA struc- traction (2). Nuclear extract (typically 10 mg of protein per
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
ture in vitro (10, 26, 31, 33). In this article, we report on the ml) was stored in aliquots at -70°C in buffer C (20 mM
purification of a nuclear G-string factor, suGF1, from em- HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
bryos of the sea urchin Parechinus angulosus and the in acid] [pH 8], 2 mM MgCl2, 0.2 mM EDTA, 20% [vol/vol]
vitro interaction of suGF1 with G strings and G-rich DNA. glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl
fluoride, 100 mM KCl). Nuclei from unfertilized oocytes
MATERIALS AND METHODS were prepared as described for 4-h embryos. Sperm nuclei
were prepared as described previously (35).
Plasmids, DNA fragments, and oligonucleotides. A 335-bp Purification of suGFl. A poly(dG) poly(dC) affinity ma-
EcoRI-HindIII fragment (probe 1) containing the G1l string trix and a binding-site (BS) affinity matrix were synthesized
of the H1-H4 intergenic region of the major early histone by cyanogen bromide coupling of poly(dG) poly(dC) or
gene battery of P. miliaris was prepared from pHP2 (1, 26). concatemers (average, 10-mers) of oligo His-wt, respec-
PstI-AvaI (101-bp) and HindIII-BamHI (605-bp) fragments tively, to Sepharose CL-4B resin (15). Column chromatog-
containing a G18 string upstream of the chicken 3A_globin raphy was performed at 4°C in buffer C (see above) contain-
gene were prepared from p3A650.1, which had been con- ing various concentrations of KCl. Bound proteins were
structed by cloning a 575-bp PvuII fragment from pBlEH1 eluted from the columns with a stepwise increase in ionic
into the HincII site of pUC9 (28). The following oligodeox- strength. Nuclear extract from 18 liters of 14-h embryo
yribonucleotides (oligos) were synthesized, purified, and cultures was applied to a phosphocellulose P11 column
annealed by standard procedures (1): His-wt, GATCAGAG (radius, 2.2 cm; bed volume, 180 ml; flow rate, 1 ml/min) in
AGGGGGGGGGGGAGGGAGAATT; His-mutl, GATCA buffer C containing 100 mM KCl. Pooled active fractions
GAGAGGGGGGGCCCCAGGGAGAATT; His-mut2, GAT eluted at 500 mM KCl from the P11 purification step were
CAGAGAGGGAGGGGAGGGAGGGGAATT; His-mut3, diluted to a final KCI concentration of 350 mM in buffer C
GATCAGAGAGGGGTAGGGGGAGGGAGAATT; His- and incubated with poly(dI-dC) (pdIdC) (Boehringer Mann-
mut4, GATCAGAGAGGGGCCCCGGGAGGGAGAATT; heim) (2 ,g/ml). The solution was applied to the poly(dG).
His-mutS, GATCAGAGACCCCGGGGGGGAGGGAGAA poly(dC) affinity column (60 p,g of DNA per ml) (radius, 4.75
TT; His-mut6, GATCAGAGAGGGTGGGGAGGGTGGG cm; bed volume, 9 ml; flow rate, 0.5 ml/min) preequilibrated
GAATT; His-mut7, GATCAGAGAGGGTGGGGTGGGTG in the same buffer. Pooled active fractions eluted at 700 mM
GGGAATT; LpS-wt, GATCTClTTCGCATGGGGGGCGTG KCl were diluted to 350 mM KCl and incubated with pdIdC
GTCTG; LpS-mutl, GATCTC'ITCGCATAGATCTCGTG (30 ,g/ml). This solution was divided into eight aliquots and
GTCTG; LpS-mut2, GATCTCTTCGCATGGGCGGGGTG loaded onto separate 1-ml BS affinity columns (44 pg of
GTCTG; and Random, GATCTTCTGCACTCTCACCGG DNA per ml) (packed in Econo-Pac 1ODG columns [Bio-
TACTGGACT (the Watson strand is given). The double- Rad]; flow-rate, 0.33 ml/min). The active fractions eluted at
stranded oligos contained 5' overhangs of GATC. DNA was 650 mM KCl were pooled, diluted to 350 mM KCl, and
3' end labeled with [a-32P]dCTP by the Kienow fill-in reac- incubated with 10 p,g of pdIdC per ml, and the process was
tion (1) to result in specific activities of 25,000 to 65,000 repeated as for the first pass over the BS affinity columns,
dpm/ng. this time using four 1-ml BS affinity columns. Purified suGF1
Preparation of sea urchin embryo nuclear extracts. Syn- eluted at 650 mM KCl was concentrated at least 10-fold by
chronized cultures (4% [vol/vol] eggs) were grown in filtered ultrafiltration in P-10 Centricon devices (Amicon). Buffer C
seawater containing 100 mg of penicillin and 50 mg of was supplemented with 0.01 and 0.02% (vol/vol) Nonidet
streptomycin per liter on a rotary shaker at 180 rpm at 21°C P-40 for the first and second passes over the BS affinity
for the appropriate period. All subsequent steps were per- columns, respectively. suGF1 was stored in aliquots at
formed at 4°C. Four-, 9-, 14-, and 24-h cultures were grown, -70°C in buffer C. Protein concentrations were determined
corresponding to prehatching (128 cells)-, hatching-blastula-, by the micro-bicinchoninic acid method (39).
late blastula-to-early gastrula-, and late-gastrula-stage em- Renaturation of suGFl from SDS-polyacrylamide gels. So-
bryos, respectively. Four-hour cultures were grown after dium dodecyl sulfate-polyacrylamide gel electrophoresis
removal of the fertilization membrane (35). Cultures were (SDS-PAGE) was performed by the Laemmli method essen-
allowed to settle, centrifuged (4,000 x g, 1 min), washed tially as described elsewhere (1). Samples were trichloroace-
twice with 0.5 M KCl and twice with buffer A containing 1 M tic acid precipitated, resuspended in SDS sample buffer,
hexylene glycol (buffer Hex-A), and resuspended in the neutralized with NaOH, boiled, and loaded onto 7 or 10%
same buffer. Buffer A was 15 mM Tris-HCl (pH 8)-65 mM (acrylamide/bisacrylamide ratio, 30:0.5) SDS-polyacryl-
KCl-15 mM NaCl-0.15 mM spermine-0.5 mM spermidine- amide gels. Silver staining was by the nonammoniacal1404 HAPGOOD AND PATTERTON MOL. CELL. BIOL.
TABLE 1. Enrichment for the purification of suGF1a
Vol suGF1 Total Protein Total amt SSp t' Yield Enrichment
Fraction ol)
(ml)
activityb
(U/,ul)
activity
(103 U) (
concn
lg/A)
of protein
(mg)
acd
(U/,ug) Step" Totale Step' Totalg
Nuclear extract 41.0 384.0 15,744 8.03 329 47.8 100 100 1 1
Phosphocellulose P11 370.0 33.9 12,543 0.0601 22.2 564 79.7 (80) 79.7 (80) 11.8 (9.8) 11.8 (9.8)
Poly(dG) poly(dC) 26.2 322.0 8,436 0.00310 0.0812 103,871 67.3 (59) 53.6 (47) 184 (152) 2,173 (1,490)
affinity matrix
BS affinity matrix
lst pass 40.6 161.0 6,537 0.00135 0.0548 119,259 77.5 (66) 41.5 (31) 1.15 (1.5) 2,495 (2,234)
2nd pass 20.0 230.0 4,600 0.00141 0.0282 163,121 70.4 29.2 1.37 3,413
a The data are from one complete purification. Calculations for a second, independent purification are shown in parentheses.
bMeasured in binding units (U).
One unit is defined as the amount of suGF1 needed to shift 0.01 ng of probe 1 in an EMSA.
c Obtained by dividing the binding activity (in units per microliter) by the protein concentration (in micrograms per microliter).
dPercentage of the total activity of the previous step.
I
Percentage of the total activity of the nuclear extract.
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
f Ratio of the specific activity to that for the previous step.
g Ratio of the specific activity to that for the nuclear extract.
method (1). Proteins were sized on three independent silver- 60 min. Thereafter, cleavage products were extracted with
stained gels by fitting polynomials to the distances migrated organic solvents, ethanol precipitated, and subjected to
by molecular weight standards (SDS-6H; Sigma) versus the electrophoresis on 6% polyacrylamide sequencing gels to-
log molecular weight by the least-squares method. gether with Maxam and Gilbert G-sequencing standards (1).
Recovery and renaturation of suGF1 (1 ,ug) after SDS-
10% PAGE was essentially as described previously (3). RESULTS
Protein recovered from the gel slice was suspended in 100 RI
of 20 mM HEPES (pH 8)-0.1 mM EDTA-1 mM dithiothre- Sea urchin embryos contain a 59.5-kDa oligo(dG). oli-
itol-6 M guanidinium-HCl-1 mM MgCl2 and renatured by go(dC)-binding nuclear protein. We performed protein-DNA
passing the sample over a 1-ml Bio-Gel P-6 (Bio-Rad) gel binding studies using nuclear extracts prepared from 14-h
filtration column equilibrated in 10 mM HEPES (pH 8)-0.1% embryos of P. angulosus and DNA fragments from a histone
(vol/vol) Nonidet P-40-1 mM dithiothreitol-100 mM KCl- gene battery. By using as a radiolabeled probe, a fragment
10% (vol/vol) glycerol-60 Rg of bovine serum albumin (BSA) prepared from the H1-H4 intergenic region of P. miliaris
per ml-5 ,uM ZnCl2. (probe 1), nuclear factor-DNA complexes Bi and B2 were
EMSA. Electrophoretic mobility shift assays (EMSAs) detected by EMSAs (data not shown, but see Fig. 4).
were carried out essentially as described elsewhere (1). A Poly(dG) poly(dC) competed efficiently for factor binding
radiolabeled DNA probe (0.5 to 1 ng) was incubated with with probe 1 (80% competition with a 20-fold weight excess
various amounts of nuclear extract for 30 min at 4°C in competitor), whereas poly(dA-dC). poly(dG-dT), poly(dA-
EMSA incubation buffer (16 mM HEPES [pH 8], 150 mM dG) poly(dC-dT), and poly(dA-dT) poly(dA-dT) did not
KCl, 16% [vol/vol] glycerol, 1.6 mM MgCl2, 0.8 mM dithio- compete at all under the same conditions with a 500-fold
threitol, 0.4 mM phenylmethylsulfonyl fluoride, 1 mM weight excess competitor (data not shown). These results
EDTA, 0.5 jig of pdldC; Boehringer) in a total volume of 25 established that sea urchin embryos contain an oligo(dG).
,ul. EMSAs with partially purified and purified suGF1 were oligo(dC) DNA-binding nuclear protein(s), to which we refer
performed in EMSA buffer containing 250 mM KCI and as sea urchin G-string factor 1 (suGF1). To further examine
supplemented with 0.01% Nonidet P-40 and 1.5 jig of BSA. the sequence specificity of the suGF1-DNA interaction,
Electrophoresis was at 4°C for 4 to 8 h at 30 mA per gel or EMSAs were performed with nuclear extracts and probe 1
overnight at 20 mA per gel in TGE (50 mM Tris-HCl [pH containing the sequence (GA)16(G)11 in the presence of
8.4], 380 mM glycine [Merck], 2 mM EDTA). Four-percent various unlabeled double-stranded DNA oligonucleotide
nondenaturing polyacrylamide gels (acrylamide/bisacryla- competitors (see Materials and Methods). The His-wt oligo,
mide ratio, 29:1) were preelectrophoresed at 30 mA for 2 h. which contains the wild-type histone H1-H4 G1l string
The electrophoresis buffer was changed, and the EMSA exhibited 50% competition at a fivefold molar excess. We
incubation mixtures were loaded directly onto the gels. Gels synthesized oligos His-mutl to His-mut7, which are all G
were dried and subjected to autoradiography. Quantitation rich but contain interruptions in the His-wt G string. Oligos
of suGF1 activity by EMSA was performed by excision of His-mutl to His-mut7 all competed for complex Bi and B2
protein-DNA complexes from the wet gel after autoradiog- formation with high affinity and specificity (5- to 12.5-fold
raphy, followed by liquid scintillation counting. molar excess for 50% competition). Oligo Random showed
DNase I footprinting. An appropriate end-labeled DNA no competition at a 100-fold molar excess. suGF1 did not
fragment (1 ng) was incubated with protein in EMSA buffer bind either the Watson or the Crick strand of the single-
for 30 min at 4°C in a total volume of 50 jil. The sample was stranded oligos. These results show that suGF1 binds with
adjusted to 15 mM MgCl2 and 15 mM CaCl2, and 3 ,ul of high affinity and specificity to G-rich DNA containing the
DNase I (grade I; Boehringer) (final concentration, 1 to 10 sequence GGGNGGG.
,ug/ml) was added. The reaction was allowed to proceed at suGF1 was purified from 14-h sea urchin nuclear extracts
4°C for 1 min, and was followed by the addition of 8.4 ,ul of by ion exchange chromatography and site-specific DNA
stop solution A (0.7 mg of proteinase K per ml, 0.12 M affinity chromatography (Table 1). The first DNA affinity
EDTA, 1% [wt/vol] SDS), mixing, and incubation at 37°C for matrix contained poly(dG) poly(dC) as a ligand, while the
-VOL. 14, 1994 G-STRING FACTORS IN DEVELOPMENTAL GENE REGULATION 1405
1NW' (k Da) Cli]d -1
(., }) NI.
SE
2(05-
66 -.
h66 -fl3L
_-+ suGFl
45 -
_9 -
* m-
..ww t_SAl
,
'4.; (
A 1 _0
-MP
l. .
AI
lane M 2 3 4 5 6
Purification NE NE PI IAf'finitv (
step 2
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
FIG. 1. Protein profile of successive suGF1 purification steps. AI
Nuclear extract (NE) (7 ,ul in lane 1 and 4 pul in lane 2); P11 pooled
active fractions (P11) (0.3 ml in lane 3); and 0.5 ml (lane 4), 0.9 ml
(lane 5), and 1.3 ml (lane 6) of pooled active fractions from the
poly(dG) * poly(dC) and first- and second-pass BS affinity columns, -:; (I
.1. -
respectively, were trichloroacetic acid precipitated and subjected to
SDS-10% PAGE and silver staining. Sizes (in thousands) of molec-
ular weight (MW) markers (lane M) are indicated on the left.
FIG. 3. DNase I footprint with nuclear extracts and purified
suGF1 over the G string of the H1-H4 fragment. Probe 1, end
labeled on the Watson strand, was incubated without (lanes 4 and 5)
second matrix (BS affinity matrix) contained concatamers of or with 6.5 p.g of 9-h nuclear extract (NE) (lane 3) or 6 ng of purified
a suGF1 site-specific oligo (His-wt) covalently coupled to suGF1 (P) (lane 2) in EMSA buffer containing 175 mM KCI. Lane 1,
Sepharose CL-4B. The final purification step showed coelu- a G-sequencing standard (G). The DNase I footprint is indicated by
tion of suGFl DNA-binding activity and a single band of 59.5 a bracket on the right, and the corresponding sequence is given on
kDa (standard deviation, 0.3 kDa) upon SDS-PAGE and the left (the numbering is relative to the main mRNA cap site [11]).
silver staining (data not shown and Fig. 1). The 59.5-kDa
protein generated the characteristic complexes Bi and B2 on
EMSA after excision of the band from the SDS-polyacryl- strand, covering the sequence (GA)2(G)11A(G)3AG. A single
amide gel followed by renaturation (Fig. 2). Southwestern DNase I footprint was also detected on the Crick strand at
(DNA-protein) blotting of the purified protein and probing the same position (data not shown). We present elsewhere a
with the radiolabeled His-wt oligo in the presence of specific detailed analysis of the purified suGF1-DNA interaction in
and nonspecific DNA competitors directly confirmed the the H1-H4 intergenic region by methylation interference and
identity of the 59.5-kDa protein as suGF1 (data not shown). footprinting with chemical and enzymatic probes (25).
Purified suGF1 produced a DNase I footprint on the suGFl is implicated as a transcription factor. A G6 string in
H1-H4 G string identical to that produced by the impure the promoter of the Lytechinus pictus cell lineage-specific
protein in nuclear extracts (Fig. 3). A single DNase I gene LpSl,B has been shown to be a positive cis-regulatory
footprint was detected from -317 to -345 bp on the Watson element (38). We synthesized 28-bp oligos containing the
wild-type G string and flanking sequences from the L. pictus
LpSl promoter (LpS-wt oligo) as well as oligos containing
changes at the G string (see Materials and Methods). In
EMSAs, the LpS-wt oligo competed well with probe 1 for
binding to purified suGF1 (2.5-fold molar excess of oligo
LpS-wt compared with equimolar oligo His-wt for 50%
competition) (data not shown). LpS-mutl, which has the six
Gs replaced with the sequence AGATAT, showed no com-
katec 2 3 4 -8 9 1l petition with a 100-fold molar excess) (data not shown).
C011tttCti0Tt - S S NS NS - S S NS NS Mutating only the G string as in oligo LpS-mutl has been
llo;,
Foldtu excr-s l0 to 10 `0 10I ( ( 5
previously shown to abolish cis activity in functional assays
FIG. 2. Recovery of suGF1 sequence-specific DNA-binding ac- (38). Changing the sequence G6C to the Spl site GGGCGGG
tivity from the 59.5-kDa SDS-PAGE band. Fractions recovered as in the LpS-mut2 oligo resulted in a fivefold decrease in
from the denatured and renatured 59.5-kDa protein band by gel suGF1 binding. EMSAs using the His-wt or the LpS-wt oligo
filtration were assayed for binding to probe 1 by EMSA. Aliquots (6 as a probe resulted in identical complexes with P. angulosus
,ul each) of the pooled active fractions eluted from the gel filtration nuclear extracts and purified suGF1 (complexes Cl and C2
column in the void volume (lanes 1 to 5) or 0.2 A.l of purified suGF1 [Fig. 4]). We found the same developmental distribution of
of the same preparation that was initially loaded onto the SDS gel
(lanes 6 to 10) was incubated with end-labeled probe 1 and a complexes Cl and C2 for the embryonic stages examined
competitor oligo in a modified EMSA buffer containing 0.025% with the His-wt oligo as the probe as that for the LpS-wt
Nonidet P-40, 175 mM KCI, 60 ,ug of BSA per ml, and 1.2 puM ZnCl2 oligo (Fig. 4). By using gene fragment probe 1, complexes Bi
for 30 min at 4°C. The fold molar excesses of specific (S) (oligo and B2 were detected by EMSA in 4-, 9-, 14-, and 24-hour
His-wt) and nonspecific (NS) (oligo Random) DNAs over probe 1 embryos as well as sperm nuclear extracts, whereas oocyte
are indicated. F, free probe 1; Bi and B2, suGF1-DNA complexes. nuclear extracts exhibited only complex B2 (data not1406 HAPGOOD AND PATTERTON MOL. CELL. BIOL.
WA.VYs()N C RICK
;7
to
a :W --
t
j .w . .
.
dWJ.AC
"O
I.
I i.
_
,,A
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
i~~ 1_
~~~~ 15.
~ ~~~~~~~
. 7 1: 12 ,3 1 j1 >
FIG. 4. Developmental distribution in P. angulosus extracts of FIG. 5. DNase I footprint with nuclear extracts over the pA_
G-string factors binding to the H1-H4 and LpS1 recognition sites. globin G string. Chicken pA_globin fragments end labeled on either
EMSAs were performed in the absence of protein (lanes 4 and 10) or the Watson (PstI-AvaI fragment) (lanes 1 to 6) or the Crick (HindIII-
in the presence of nuclear extracts (4 ,ug of protein) from 4- (lanes 5 BamHI fragment) (lanes 7 to 15) strand were incubated in the
and 11), 9- (lanes 6 and 12), 14- (lanes 7 and 13), and 24-h (lanes 8 and absence (lanes 1, 2, and 11 to 13) or presence of 16 ,ug (lane 4), 32 p.g
14) embryos or purified suGF1 (0.6 ng) (lanes 9, 15, and 16), using (lanes 3, 7, and 8), or 48 ,ug (lanes 9 and 10) of the 9-h embryo
the end-labeled His-wt oligo (lanes 4 to 9) or LpS-wt oligo (lanes 10 nuclear extract protein. G-sequencing standards are shown in lanes
to 16) as a probe. Lane 16, a shorter exposure of lane 15. For 5, 6, 14, and 15. The DNase I concentrations were 3 p,g/pl (lanes 1
comparative purposes, the results of EMSAs with gene fragment to 4, 7 to 10, and 13) or 1.5 p.g/p.l (lanes 11 and 12). The base pair
probe 1 in the absence of protein (lane 1) and in the presence of pure positions of each strand (relative to the main mRNA cap site) are
suGF1 (0.1 ng) (lane 2) or 14-h nuclear extract (0.4 pLg) (lane 3) are indicated. Solid boxes, DNase I footprint; open box, weaker pro-
shown on the same gel. F, free probe; Cl and C2, suGF1-oligo tection.
complexes; Bi and B2, suGF1-probe 1 complexes. Half a nanogram
of probe 1 (20,000 cpm), the His-wt probe (18,000 cpm), or the
LpS-wt probe (45,000 cpm) was used per incubation. Note that the translational frame occupied by an in vitro-positioned nucle-
apparent minor difference between relative suGF1 binding activities osome (27) reveals that the suGF1 recognition site lies
for 14-h extracts with the two oligo probes (compare lanes 7 and 13) entirely within and close to the dyad of the positioned
was not observed in several repeat experiments. nucleosome. The binding site for BGP1 on the PA-globin
promoter also occurs within an in vitro-positioned nucleo-
some, although in this case the G string occurs near the
shown). We have consistently observed that EMSAs using border of the positioned nucleosome, where the DNA-
short oligos (about 30 bp) as probes result in more slowly histone interactions may be relatively weak (18). These
migrating and less well resolved doublets (Cl and C2 [Fig. results are summarized in Fig. 6. On the basis of these data,
4]) with suGF1 than those obtained with longer DNA frag- we propose that suGF1 may be functionally and structurally
ments (Bi and B2 [Fig. 4]). The slower-mobility doublets are related to BGP1.
most likely due to charge effects. The sequence specificity of
purified suGF1 for DNA sequences containing the LpS1
promoter G string and mutations thereof is the same as that DISCUSSION
determined for a previously identified ectoderm G-string Biochemical and DNA-binding properties of suGF1. We
factor (38). This factor was detected in nuclear extracts from have purified an oligo(dG) oligo(dC)-binding protein
the ectoderm as well as the gastrula and blastula stages of L. (suGF1) to near homogeneity from sea urchin embryos by
pictus embryos as a slow-mobility doublet in EMSAs with sequence-specific DNA affinity chromatography. From sil-
gene fragments containing the LpS1 G string (38). Our data ver-stained gels, the purity of the final preparation is esti-
strongly suggest that suGF1 is the P. angulosus homolog of mated to be at least 85%. Our results strongly suggest that
the L. pictus ectoderm G-string factor. the same protein (suGF1) is involved in two sequence-
suGFl may be related to a chicken G-string factor. A specific protein-DNA complexes resolved by EMSA. Bi and
chicken G-string factor, BGP1, has been shown to bind in B2 in the same relative proportions were reproducibly
vitro to a G string upstream of the chicken 3A-globin gene (7, detected by EMSAs with nuclear extracts and with purified
22, 28). Competitive EMSAs showed that suGF1 in 9-h sea suGF1 as well as after renaturation of DNA-binding activity
urchin nuclear extracts binds to 3A-globin G-string-contain- from a single protein band (59.5 kDa) on an SDS-polyacryl-
ing DNA fragments with a relative affinity similar to that amide gel. We could not detect any difference between the
with which it binds to the sea urchin histone gene fragment DNA-binding specificity of Bi and that of B2 by EMSA
(data not shown). suGF1 binding resulted in a footprint on using several DNA competitors. No evidence could be found
the 3A-globin gene fragment (Fig. 5) that was virtually for differential phosphorylation or RNA association for the
identical to that obtained with BGP1. A comparison of the proteins in Bi and B2 (data not shown). The cause of the
DNA base pairs protected in the DNase I footprint by suGF1 presence of the two complexes in EMSA is, however, not
on the H1-H4 gene fragment with the previously determined known.VOL. 14, 1994 G-STRING FACTORS IN DEVELOPMENTAL GENE REGULATION 1407
A sea urchin H1-H4 nuclear extracts containing suGF1 over the G string in the
BA-globin promoter is indistinguishable from that obtained on
-410 -370
this gene fragment with chicken erythrocyte nuclear extracts
GACATGAAAC ACACTCAATT CAAC ATATTT AGAGGAAGGG AGAGAGAG AGAGAGA
CTQTACTTTG TGTGAGTTAA GTTG TATAAA TCTCCTTCCC TCTCTCTCTC TCTCTCT
(7, 28). There are indications that BGP1 and suGF1 may differ
in some respects. While BGP1 was shown to have a minimum
-350 -310 requirement for seven Gs for sequence-specific DNA binding
GAG AGQGAGAGAG AGGGGGGGG GGAGGGAGAA TTGCCCAA&A CACTGTALAT GTAGC
CTC TCTCTCTCTC TCCCCCCCCC CCTCCCTCTT AACGGGTTTT GTGLCATTTA CATCG
(4), we have found that suGF1 can recognize the sequence
~~~~~* G6C. It is not possible with the available data to deduce
-290 -270
whether these results reflect a difference between the DNA-
GTTAA TGAACTTTTC ATCTCATCGA CTGCGCGTGT ATA" GGATGA TTATAAGCTT binding specificities of BGP1 and suGF1. BGP1 was shown to
CAATT ACTTGAAAAG TAGAGTAGCT GACGCGCACA TATT CCTACT AATATTCGAA
require the presence of Zn2+ for DNA binding (22), whereas
we were unable to show a Zn2+ requirement for suGF1 (25).
This may reflect differences between the structures of the two
B chicken E_A-globin proteins or may reflect differences between the experimental
conditions.
While BGP1 appears to be a tissue- and developmental-
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
-220 * ** -166
ATAGAGCTGC AGAG CTGGGA ATCGGGGGGG GGGGGGGGGG GCGGGTGGTG GTGTGGC stage-specific chicken factor (22), suGF1 may have a more
TATCTCGACG TCAC LGACCCT TAGCCCCCCC CCCCCCCCCC CGCCCACCAC CACACCG general distribution in the sea urchin embryo. We were
unable to detect any qualitative differences by EMSA or
-140 -110 DNase I footprinting between suGF1 DNA-binding activities
CAC GGATCTGGGC ACCTTGCCCT GAGCCCCACC CTGATGCCGC GTTCCCTCCC CCGGG
GTG CCTAGACCCG TGGAACQGGA CTCGGGGTOG GACTACGQCG CAAGGGA-GG GGCCC for different embryonic stages. Quantitation of G-string
binding activity by EMSA revealed that the variation be-
-80
GTGCC AAGGCTGG GCCCCTCCGG AGATGCAGCC ATTGCCG G TGCCCGGGGA tween different batches of extract of the same developmental
CACOG TTCCQACCCC CGGGGAGGCC TCTACGTCGG TTA CQCCC c ACGGCCCCT stage was as great as the variation between different stages
(two- to fourfold). Accurate comparative quantitation of
FIG. 6. Summary of suGF1 and BGP1 DNase I protection and suGF1 expression, concentration, and activity at different
nucleosome positioning over sea urchin H1-H4 (A) and chicken developmental stages can most likely be assessed only by
3A-globin (B) genes. The footprints obtained by others with BGP1
are indicated (small asterisks) above (Watson strand) and below
cDNA or antibody probes and functional assays other than
(Crick strand) the sequence. The footprints obtained by us with DNA binding.
suGF1 are indicated by solid (strong protection) and dashed (weak suGF1 is most likely the P. angulosus homolog of the L.
protection) lines above (Watson strand) and below (Crick strand) the pictus ectoderm G-string factor, on the basis of their indis-
sequences. The borders of a positioned nucleosome (brackets) and tinguishable DNA target site specificities and the distribu-
the position of the dyad (large asterisk) are indicated. Base pair tions of DNA-binding activity with the His-wt and LpS-wt
numbering is relative to the cap site. oligos for the different embryonic stages we examined. In
addition, we report elsewhere that the optimal ionic strength
for DNA binding and the insensitivity of binding to exoge-
Although the EMSA competition results do not allow us to nous EDTA is the same for suGF1 (25) as that reported for
define precisely the minimum requirements for specific DNA the ectoderm G-string factor (38).
binding of suGF1, several deductions can be made. All the A possible biological role for suGFl and G-string factors
competition results, except that with the LpS-wt oligo, are involving alterations in chromatin structure. We have shown
consistent with a requirement for specific binding of at least that suGF1 has a DNA-binding specificity similar to those of
two triplets of Gs interrupted by a single base pair. How- several factors which recognize G-rich sequences within the
ever, the LpS-wt oligo containing the sequence (G)6C is also context of pur. pyr stretches upstream of genes (6, 9, 12, 24,
a specific high-affinity binding site for suGF1, showing that 29, 34). In addition, several of these factors have been
suGF1 can bind to a G string of as few as six Gs. Tentative implicated in gene regulation via alterations in chromatin
consensus sites may be defined as GGGNGGG or GGGGG structure within the pur- pyr region (see the introduction).
GC, although it is possible that G-rich flanking regions are While the role of G strings in sea urchin histone gene
also necessary and that further degeneracy within the con- regulation has not been directly investigated in functional
sensus sequences is allowed. studies, there is evidence for a role of G strings in transcrip-
The size and/or DNA-binding properties of suGF1 distin- tional regulation of several unrelated genes in the sea urchin
guish it from several factors shown to bind to G-rich recog- embryo (38). Several lines of evidence indicate that suGFl
nition sites. Factors Spl (16), CTCF (23), and H4TF-1 (5) may be involved in regulation of expression of the sea urchin
have DNA recognition sites that are similar to those of suGF1 histone gene battery by a mechanism similar to that pro-
but have been shown to be proteins larger than 100 kDa. posed for BGP1 and chicken 3A'-globin gene eXpression (22).
Other factors implicated in human c-myc gene regulation Alterations in chromatin structure in the A -globin gene
appear to differ from suGFl in that they do not result in a have been mapped to the G-string region and correlate with
DNase I footprint on their G-rich recognition site (factor PuF the tissue-specific expression of the gene (13). Major alter-
[29]) or are associated with RNA (factor NSE [6]). The ations in chromatin structure have been found to correlate
biochemical and DNA-binding properties of suGF1 are re- with the developmental temporal expression pattern of the
markably similar to those of BGP1, the chicken factor impli- sea urchin early histone genes (37). However, a detailed
cated in PA-globin gene expression (4, 22). BGP1 has been analysis of the developmental change in chromatin structure
partially purified from chicken erythrocyte nuclear extracts at the G string in the H1-H4 intergenic region of the P.
(22). The molecular weights of BGP1 and suGF1 differ only by miliaris gene battery has not been done. We have no direct
approximately 7 kDa, although it should be noted that it is not evidence for a biological role for suGF1 or the H1-H4 G
known which of several bands in the 66- to 67-kDa region is string. This is also the case for BGP1 and the pA_globin G
BGP1 (22). The DNase I footprint obtained with sea urchin string. Deletion of the G string has no effect on transcription1408 HAPGOOD AND PATI7ERTON MOL. CELL. BIOL.
of the iA-globin gene in nuclear extracts (in the absence of 8. Emerson, B. M., J. M. Nickol, and T. C. Fong. 1989. Erythroid-
nucleosomes) (8) or in cells in transient transfection expres- specific activation and derepression of the chick 3-globin pro-
sion studies (22). A possible reason for these results may be moter in vitro. Cell 57:1189-1200.
the difficulty of mimicking the effects of alterations in 9. Hall, D. J. 1990. Regulation of c-myc transcription in vitro:
chromatin structure in these assays. dependence of the guanine-rich promoter element Melal. On-
cogene 5:47-54.
Understanding the functional role and relationship be- 10. Hentschel, C. C. 1982. Homocopolymer sequences in the spacer
tween suGF1 and other G-rich binding factors will require of the sea urchin histone gene repeat are sensitive to S1
the cloning of the cDNAs and the use of functional assays nuclease. Nature (London) 295:714-716.
such as transcription with reconstituted chromatin tem- 11. Hentschel, C. C., and M. L. Birnstiel. 1981. The organization
plates. It is possible, although by no means proven, that the and expression of histone gene families. Cell 25:301-313.
function of these G-string factors is specifically related to 12. Hoffmann, E. K., S. P. Trusko, M. Murphy, and D. L. George.
DNA conformation and/or alterations in chromatin struc- 1990. An S1 nuclease-sensitive homopurine/homopyrimidine
ture. The presence of a positioned nucleosome or suGF1 at domain in the c-Ki-ras promoter interacts with a nuclear factor.
Proc. Natl. Acad. Sci. USA 87:2705-2709.
the G string may be mutually exclusive, with suGF1 playing 13. Jackson, P. D., and G. Felsenfeld. 1985. A method for mapping
a role in maintaining a nucleosome-free region during tran- intranuclear protein-DNA interactions and its application to a
scription. The ability of suGF1 to recognize its DNA-binding nuclease hypersensitive site. Proc. Natl. Acad. Sci. USA 82:
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
site within a positioned nucleosome may be a crucial first 2296-2300.
step in a process of nucleosome displacement or destabili- 14. Johnson, A. C., Y. Jinno, and G. T. Merlino. 1988. Modulation
zation. Alternatively, suGF1 binding to newly replicated of epidermal growth factor receptor proto-oncogene transcrip-
DNA may exclude nucleosomes. Experiments are in prog- tion by a promoter site sensitive to S1 nuclease. Mol. Cell. Biol.
ress to characterize the interaction of suGF1 with chromatin. 8:4174-4184.
15. Kadonaga, J. T. 1991. Purification of sequence-specific binding
proteins by DNA affinity chromatography. Methods Enzymol.
ACKNOWLEDGMENTS 208:10-23.
16. Kadonaga, J. T., K. R. Carner, F. R. Masiarz, and R. Tjian.
This research was supported by grants from the Foundation for 1987. Isolation of cDNA encoding transcription factor Spl and
Research Development, Republic of South Africa, and the UCT functional analysis of the DNA binding domain. Cell 51:1079-
research committee to J.H. D.P. was a recipient of a postgraduate 1090.
research scholarship from AECI. 17. Karsenty, G., and B. de Crombrugghe. 1991. Conservation of
We thank C. von Holt for encouragement, discussions, and binding sites for regulatory factors in the coordinately expressed
critical reading of the manuscript. We thank G. H. Goodwin for the al (I) and a2 (I) collagen promoters. Biochem. Biophys. Res.
kind gift of p,BA650.1. We thank H.-G. Patterton and M. Birnstiel for Commun. 177:538-544.
pHP2 and the P. miliaris histone gene battery, respectively. 18. Kefalas, P., F. C. Gray, and J. Allan. 1988. Precise nucleosome
positioning in the promoter of the chicken pA globin gene.
Nucleic Acids Res. 16:501-517.
ADDENDUM IN PROOF 19. Kohwi, Y., and T. Kohwi-Shigematsu. 1991. Altered gene ex-
pression correlates with DNA structure. Genes Dev. 5:2547-
In a recent study, published after submission of our 2554.
manuscript, it was found that BGP1 is not able to derepress 20. Kohwi, Y., S. R. Malkhosyan, and T. Kohwi-Shigematsu. 1992.
nucleosome-repressed p-globin templates in vitro (M. C. Intramolecular dG. dG. dC triplex detected in Escherichia coli
Barton, N. Madani, and B. M. Emerson, Genes Dev. cells. J. Mol. Biol. 223:817-822.
7:1796-1809, 1993). 21. Kohwi-Shigematsu, T., and Y. Kohwi. 1985. Poly(dG) poly(dC)
sequences, under torsional stress, induce an altered DNA
conformation upon neighboring DNA sequences. Cell 43:199-
REFERENCES 206.
1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. 22. Lewis, C. D., S. P. Clark, G. Felsenfeld, and H. Gould. 1988. An
Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in erythroid-specific protein that binds to the poly(dG) region of
molecular biology. John Wiley and Sons, New York. the chicken P-globin gene promoter. Genes Dev. 2:863-873.
2. Barberis, A., G. Superti-Furga, and M. Busslinger. 1987. Mutu- 23. Lobanenkov, V. V., R. H. Nicolas, V. V. Adler, H. Paterson,
ally exclusive interaction of the CCAAT-binding factor and of a E. M. Klenova, A. V. Polotskaja, and G. H. Goodwin. 1990. A
displacement protein with overlapping sequences of a histone novel sequence-specific DNA binding protein which interacts
gene promoter. Cell 50:347-359. with three regularly spaced direct repeats of the CCCTC-motif
3. Calzone, F. J., C. Hoog, D. B. Teplow, A. E. Cutting, R. W. in the 5'-flanking sequence of the chicken c-myc gene. Onco-
Zeller, R. J. Britten, and E. H. Davidson. 1991. Gene regulatory gene 5:1743-1753.
factors of the sea urchin embryo. I. Purification by affinity 24. McKeon, C., A. Schmidt, and B. de Crombrugghe. 1984. A
chromatography and cloning of P3A2, a novel DNA-binding sequence conserved in both the chicken and mouse a2(I)
protein. Development 112:335-350. collagen promoter contains sites sensitive to S1 nuclease. J.
4. Clark, S. P., C. D. Lewis, and G. Felsenfeld. 1990. Properties of Biol. Chem. 259:6636-6640.
BGP1, a poly(dG)-binding protein from chicken erythrocytes. 25. Patterton, D., and J. Hapgood. 1994. suGF1 binds in the major
Nucleic Acids Res. 18:5119-5126. groove of its oligo(dG) * oligo(dC) recognition sequence and is
5. Dailey, L., S. B. Roberts, and N. Heintz. 1988. Purification of the excluded by a positioned nucleosome core. Mol. Cell. Biol. 14:
human histone H4 gene-specific transcription factors H4TF-1 1410-1418.
and H4TF-2. Genes Dev. 2:1700-1712. 26. Patterton, H.-G., and C. von Holt. 1993. Negative supercoiling
6. Davis, T. L., A. B. Firulli, and A. J. Kinniburgh. 1989. Ribonu- and nucleosome cores. I. The effect of negative supercoiling on
cleoprotein and protein factors bind to an H-DNA forming the efficiency of nucleosome core formation in vitro. J. Mol.
c-myc DNA element. Possible regulators of the c-myc gene. Biol. 229:623-636.
Proc. Natl. Acad. Sci. USA 86:9682-9686. 27. Patterton, H.-G., and C. von Holt. 1993. Negative supercoiling
7. Emerson, B. M., C. D. Lewis, and G. Felsenfeld. 1985. Interac- and nucleosome cores. II. The effect of negative supercoiling on
tion of specific nuclear factors with the nuclease-hypersensitive the positioning of nucleosome cores in vitro. J. Mol. Biol.
region of the chicken adult p-globin gene: nature of the binding 229:637-655.
domain. Cell 41:21-30. 28. Plumb, M. A., R. H. Nicolas, C. A. Wright, and G. H. Goodwin.VOL. 14, 1994 G-STRING FACTORS IN DEVELOPMENTAL GENE REGULATION 1409
1985. Multiple sequence-specific DNA binding activities are of the promoter region and 3' end of the human insulin receptor
eluted from chicken nuclei at low ionic strengths. Nucleic Acids gene. J. Biol. Chem. 264:16238-16245.
Res. 13:4047-4065. 35. von Holt, C., W. F. Brandt, H. J. Greyling, G. G. Lindsey, J. D.
29. Postel, E. H., S. Mango, and S. J. Flint. 1989. A nuclease- Retief, J. D. Rodrigues, S. Schwager, and B. T. Sewell. 1989.
hypersensitive element of the human c-myc promoter interacts Isolation and characterization of histones. Methods Enzymol.
with a transcription initiation factor. Mol. Cell. Biol. 9:5123- 170:431-523.
5133. 36. Wells, R. D., D. A. Collier, J. C. Hanvey, M. Shimizu, and F.
30. Retief, J. D., B. T. Sewell, and C. von Holt. 1987. Nucleosome Wohlrab. 1988. The chemistry and biology of unusual DNA
cores assembled in vitro occupy two preferred frames flanking structures adopted by oligopurine oligopyrimidine sequences.
the histone Hi gene from Psammechinus miliais. Biochemistry FASEB J. 2:2939-2949.
26:4449-4453. 37. Wu, T.-C., and R. T. Simpson. 1985. Transient alterations of the
31. Schon, E., T. Evans, J. Welsh, and A. Efstratiadis. 1983. chromatin structure of the sea urchin early histone genes during
Conformation of promoter DNA: fine mapping of Si-hypersen- embryogenesis. Nucleic Acids Res. 13:6185-6203.
sitive sites. Cell 35:837-848. 38. Xiang, M., S.-Y. Lu, M. Musso, G. Karsenty, and W. H. Klein.
32. Simpson, R. T. 1991. Nucleosome positioning: occurrence, 1991. A G-string positive cis-regulatory element in the LpSl
mechanisms and functional consequences. Prog. Nucleic Acid promoter binds two distinct nuclear factors distributed non-
Res. 40:143-184. uniformly in Lytechinus pictus embryos. Development 113:
33. Stokrovi, J., M. Vojtiskova, and E. Palecek. 1989. Electron 1345-1355.
Downloaded from http://mcb.asm.org/ on May 16, 2021 by guest
microscopy of supercoiled pEJ4 DNA containing homopurine - 39. Zhang, J.-X., and P. J. Hulling. 1990. pH and buffering in the
homopyrimidine sequences. J. Biomol. Struct. Dyn. 6:893-897. bicinchoninic acid (4,4'-dicarboxy-2,2'-biquinoline) protein as-
34. Tewari, D. S., D. M. Cook, and R. Taub. 1989. Characterization say. Anal. Biochem. 188:9-10.You can also read