Molecular analysis of goose parvovirus eld strains from the Derzsy's disease outbreak revealed the local European-associated variants
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Molecular analysis of goose parvovirus eld strains
from the Derzsy’s disease outbreak revealed the
local European-associated variants
Hakan Isidan
Dicle Universitesi Veteriner Fakultesi
Turhan Turan ( tturan@cumhuriyet.edu.tr )
Sivas Cumhuriyet Universitesi https://orcid.org/0000-0002-4223-1734
Mustafa Ozan ATASOY
Cumhuriyet Universitesi Veteriner Fakultesi
Alparslan Coskun
Cumhuriyet Universitesi Veteriner Fakultesi
Research Article
Keywords: Derzsy's Disease, goose parvovirus, rep, VP1, waterfowl, molecular characterization
DOI: https://doi.org/10.21203/rs.3.rs-260589/v1
License: This work is licensed under a Creative Commons Attribution 4.0 International License.
Read Full License
Page 1/17Abstract
Since the rst recognition in the early '60s, Derzsy’s disease has occasioned signi cant economic losses
in the goose meat industry through the world. Today, Derzsy’s disease still maintains its importance for
small-scale waterfowl farming, despite not having a remarkable impact on public health. In the present
study, we investigated the distribution of goose parvovirus (GPV) strains and its potential variants from
the 2019 outbreak in Turkey. The tissue samples were obtained from the infected eggs and the goslings,
which were raised in the distinct farming areas of the various provinces. For this purpose, a novel primer
set which ampli es the 630 bp of VP3 region was designed to con rm the GPV infection by conventional
PCR method. After the diagnosis, 4709 base nucleotide data including structural, non-structural and 5'
inverted terminal repeat regions were obtained from the three samples in the Middle Anatolian region. The
multiple comparison and phylogenetic analyses together demonstrated that the eld strains clustered
with European group 2 and presented a series of unique amino acid substitutions which could determine
the virulence. These results con rmed the European-related eld strains caused the outbreak in minor
Asia, which could assist to understand the GPV circulation between Asia and Europe.
1. Introduction
Derzsy’s disease is a severely contagious disease with high mortality, especially in young domestic geese
(Anser anser domesticus) and Muscovy ducks (Cairina moschata). The etiological agents are known as
“waterfowl parvoviruses” and include goose parvovirus (GPV) and Muscovy duck parvovirus (MDPV) and
together they are classi ed under the name of Anseriform Dependoparvovirus 1 [1–3]. GPV and MDPV
share 79.7–85.0% identity based on whole genomic sequences [4]. Waterfowl parvoviruses consist of
naked icosahedral structures assembled by viral proteins (VPs), which encapsidate single stranded, linear
DNA genomes with U shaped hairpins (Inverted Terminal Repeats, ITRs) at both ends [5]. The parvoviral
genome is ~ 5.1 kb in length and carries both structural (VP1, VP2 and VP3) and non-structural gene
(rep1 and rep2) coding sequences, which abundantly express multiple genes by differential splicing
mechanisms [6]. Rep proteins speci cally bind to ITRs to initiate viral DNA replication, while VP1, VP2 and
VP3 proteins generate the progeny virus capsids with the ratio of 1:1:8, respectively [7–9].
GPV has different pathogenicity and host ranges and is distinguishable serologically through
neutralization tests. GPV has been observed in geese, Muscovy ducks, crossbreed ducks and wild ducks;
however, MDPV strains have only been discovered in Muscovy ducks so far [9–11]. The progression of
Derzsy’s disease may be acute, subacute or chronic. Acutely infected geese present with symptoms
include anorexia, nasal and ocular discharge, conjunctivitis, severe diarrhea, hepatitis, hydropericardium,
myocarditis and, sometimes, mucosal necrosis in the oral cavity [12, 13]. Furthermore, one- to three-week-
old geese may develop prolonged form of disease, upon recovery from the initial infection. This is often
called “short beak and dwar sm syndrome” (SBDS) and is characterized by growth restriction and feather
loss. It has been demonstrated that West-European cluster strains of GPV are capable of establishing
SBDS in geese [14–16].
Page 2/17Incidences of Derzsy’s Disease have been frequently reported from domestic and wild geese in European
countries including Germany [17], the United Kingdom [18], Poland [19] and Sweden [20]. Vaccination
programs include attenuated or subunit vaccine formulations, which have been broadly administered to
geese ocks in Europe to immunize them against the disease [1]. On the other hand, Turkey lacks a
national control and prevention program for GPV, since the raising of geese is an insigni cant local and
family-controlled enterprise. In this study, we aimed to provide comparative analysis and characterization
GPV based on a known epidemic of Derzsy’s disease cases to provide a better understanding of a
potential viral reservoir in Minor Asia territory.
2. Materials And Methods
2.1. Clinical Samples and DNA extraction
Beginning from April 2019, thirty-two Lindovskaya breed goslings from the various provinces were
presented to the small animal clinic of the Cumhuriyet University. These goslings were severely
dehydrated and anorectic and showed listless and depression. The acute diarrhoea was commonly
observed in most of the patients. Sixteen goose embryonated eggs from same farms were also subjected
for this study (for the details of the samples, see Supplementary Table 1 and Supplementary Fig. 2).
Samples of the internal organs including intestine, liver, heart, spleen and brain were collected at the post-
mortem examination and submitted to the Virology laboratory for further analysis. Tissue homogenates
were prepared from the specimens for each individual gosling separately. Brie y, 5 ml sterile PBS was
added in 1 g for each tissue and grinded with sterile pestle. The same process was applied for the
embryonated eggs to obtain tissue homogenates. These homogenates were centrifuged at 3000 x g 4°C
for 5 minutes with Rotanta 460R refrigerated centrifuge (Hettich, Germany). Supernatants were harvested
for the DNA extraction and for this purpose, commercial viral DNA extraction kit (GF-1 Vivantis, Malaysia)
was used as per the manufacturer’s instructions. DNA purities were interpreted according to the ratio of
absorbance at 260 nm and 280 nm in UV-Vis spectrophotometry (Denovix DS-11, USA).
2.2. Primer design and PCR Ampli cation of partial GPV
sequences
Publicly available genomic sequence data of GPV and MDPV were obtained from the GenBank
(https://www.ncbi.nlm.nih.gov/nuccore) and aligned using MUSCLE alignment algorithm [21] in the
Geneious Prime 2020.0.3 software [22]. The alignment results were used to determine pairs of
consecutive primer sets, which would match with the most conserved areas in the genome for the
directed sequencing method [23]. A pair of primer (GoPV-3313F and GoPV-3942R) which could amplify
the 630 bp DNA fragment of the VP3 gene was utilized to detect viral genome (Supplementary Fig. 1).
PCR were performed using 500 ng template DNA and the reactions were set up as follows: 95°C for 2 min;
denaturation (94°C for 45 sec), annealing (48–56°C for 45 sec; see Table 1) and extension (72°C for 1
min) in total of 40 cycles; and nal extension (72°C for 10 min).
Page 3/17After reaction, positive samples were detected by running these PCR products through 1% agarose gel
and displayed in imaging system (Quantum ST4 Vilber Lourmat, France) based on the observation of 630
bp amplicon according to VC 1000 bp DNA ladder (Vivantis, Malaysia).
Page 4/17Table 1
Primer sets adopted to amplify the nearly whole genome and the characteristics (position, tm, product
size) of these sets. Positions of the primer set were determined according to the GPV reference strain
(NC_001701.1). Gray color indicates the primer set used for the detection of GPV.
Primer Sequence (5’-3’) Position Tm. Product Reference
name Size
GoPV-1F CTCATTGGAGGGTTCGTTCGT 1-203 56 203 bp [24]
C°
GoPV- GCATGCGCGTGGTCAACCTAACAGCCGGAAA
203R
GoPV- RTRTTTCCGGCTGTTAKGTTG 170– 50 656 bp This
170F 825 C° study
GoPV- GAATGTACTCACTGCCTTCTTC
825R
GoPV- TTTCTACCGGAGTTTGGGAGC 655– 53 630 bp
655F 1284 C°
GoPV- CTCGGTTCTCAGTGAGCCAY
1284R
GoPV- TGGGCCTTTACYAATATGCCWT 1050– 53 630 bp
1050F 1679 C°
GoPV- CTCCTCCCACCAAATCARCAT
1679R
GoPV- ATATGGCTCTACGGACCTGC 1530– 53 630 bp
1530F 2159 C°
GoPV- CACAGGAATYGGAGCRACTG
2159R
GoPV- TTCCTGAACGAGCGAACGAG 2035– 54 611 bp
2035F 2645 C°
GoPV- TTTATCMAGGCCGTTACCAGG
2645R
GoPV- TCGTGGCGGAATCTGAAAGC 2490– 55 610 bp
2490F 3099 C°
GoPV- AGGCATTACCCACTCCATCG
3099R
GoPV- AGATAGCCTCCAASACGACCR 2765– 52 650 bp
2675F 3414 C°
GoPV- TYGTYTGATCCTGCGTTGTGA
3414R
GoPV- GGCARAGACTTATCAACAAC 3313– 48 630 bp
3313F 3942 C°
Page 5/17Primer Sequence (5’-3’) Position Tm. Product Reference
name Size
GoPV- TGTTYCCATTAYTCCAGATG
3942R
GoPV- CCCYAGTCAGATGCTRAGAACA 3629– 52 630 bp
3629F 4258 C°
GoPV- TCYCTGTTCTGCCAMACCATT
4258R
GoPV- CACGGAMGARCARGAAGTAGCA 4106– 52 570 bp
4016F 4675 C°
GoPV- GCGCCAGGAAGTGYTTTATTT
4675R
GoPV- TTYCATCCTTCTCCRAAYCT 4311– 48 399 bp
4311F 4709 C°
GoPV- TMCAATRWGACTCAAGGACA
4709R
2.3. Sequence alignment and Bioinformatic analysis
Three samples were selected from the positive samples of Yozgat, Konya and Corum for further
characterization. Brie y, chosen DNA specimens were ampli ed by the overlapping primer sets (see
Table 1 and the supplementary Fig. 1) and the expected size of products were observed in standard gel
electrophoresis. These amplicons were further excised from the gel and puri ed using GF-1 AmbiClean Kit
(Vivantis, Malaysia), then sequenced twice bidirectionally using the BigDye Terminator Cycle Sequencing
Kit (Applied Biosystems, USA) on an ABI 3100 automated sequencer (Applied Biosystems, USA).
The initial evaluation of the primary sequencing data quality was processed in Geneious Prime®
2020.0.3 software [22]. The four-colour nucleotide chromatogram values were interpreted and the data
with poor quality were re-sequenced for achieving the most accurate results. Contiguous sub-sequences
were mapped to a reference sequence accessed from GenBank (Accession no.:NC_001701.1). Therefore,
positions of the structural and non-structural genes; intergenic regions and terminal repeat regions were
established in the sequencing data.
Once the coding sequences were revealed, both nucleotide and deduced amino acid sequences were
subjected to multiple sequence alignment (MSA) to determine sequence identity percentages and the
similarity scores. For this purpose, VP1-VP2 partial, VP3 partial, VP1 complete sequences, rep complete
sequences and all-length fragment data were individually aligned with other available sequences
obtained from the GenBank using Clustal (mBed algorithm) [24]. The optimal substitution models were
determined using MEGA X software [25]. Bayesian information criterion (BIC) was used to select the best-
t models for each dataset. Datasets were also investigated for the potential recombination events via
RDP4 v4.100 software [26]. For this purpose, both structural and non-structural genes were analyzed for
Page 6/17possible recombination events using available algorithms (RDP, GENECONV, Chimaera, MaxChi,
BootScan, SiScan and 3Seq) with their default parameters (P-value cutoff = 0.05). The events detected
with at least three algorithms were considered as a recombinant strain. Selection pressures for both VP1
and rep genes were estimated as the mean ratio of the number of nonsynonymous substitutions to the
number of synonymous substitutions (dN/dS). Overall scores were calculated using MEGA 7 [27].
Phylogenetic analyses were performed for the nearly full length sequences, VP1 and the rep, using the
PhyML 3.3.20180621 module [28] in Geneious Prime® 2021.0.3 [22] and are bootstrapped for 100 times.
For this purpose, ninety-two complete genomic data including GPV, MDPV and AAAV (Avian adeno-
associated virus) strains were selected for the construction of trees. Tamura-Nei (TN93), Hasegawa-
Kishino-Yano (HKY85) or Kimura model were used as nucleotide substitution model. For the phylogeny of
the VP1-VP2 and the VP3 partial sequences, further partial genomic data of the European-originated virus
were also included.
3. Results
3.1. Molecular detection of virus
We screened fty samples for the presence of GPV by using conventional PCR with GoPV-3313F and
GoPV-3942R primer sets targeting the 630 nt fragments of the VP3 partial sequence. The results showed
that all of the samples were positive for GPV. Next, three of the PCR products were selected for
bidirectional sequencing. At this point, the priority was given to the samples from farms located in the
Middle Anatolian region, where the goose production is intense. Thus, sample 2 from “farm G” in Yozgat,
a sample from “farm A” in Corum, and a third sample from “farm I” in Konya were determined for further
study (See supplementary table 1).
3.2. Nearly full-length genomic sequence analysis
We successfully obtained 4709 base sequencing data from our three samples with the lack of 3' UTR.
Data from three samples included 5' UTR between the 1st and 444th nt, a replication associated gene
(rep) between 537th and 2.420th nt, and the gene coding sequences of the structural VPs between the
2439 and 4637th nt. One-fourth of the rep cds consisted of SF3 helicase, positioned between 1461st and
1931st nt, whereas the structural ORF encoded three VPs—VP1 (2439–4637), VP2 (2874–4637) and VP3
(3033–4637).
A pairwise comparison of multiple sequence alignment according to 4709 base-length data
demonstrated that Turkish strains closely related to each other and shared 99.81–99.91% nucleotide
identity. These strains also presented the highest identity with three European originated strains—virulent
B (NC_001701.1), VG32/1 (EU583392.1) and GPV GER (KU684472.1)—varying between 98.00% and
98.90%. The nucleotide identity percentages for other chosen strains were shown in Table 2.
Page 7/17Table 2
The nucleotide identity percentages between the Minor Asian strains and some other well-known strains.
a. NC_001701, virulent B strain [8]. b. EU583391, strain 06-0329 [35]. c. BDU22967, strain FM [8]. d.
NC_004828 strain ATCC VR-865 [53]. e. EU583392, strain VG32/1 [35]. f. KU684472.1, GPV GER [55]. g.
MF441222 strain SDLY1602 [56].
Strains European GPV Asian MDPV AAAV European SBDS- NGPV
straina GPV related straing
GPV Strainc straind
strainb vaccine EU
straine strainf
Konya/19 98.79% 95.97% 80.32% 48.90% 98.60% 98.00% 95.76%
Corum/19 98.82% 95.93% 80.30% 48.92% 98.62% 98.02% 95.76%
Yozgat/19 98.90% 95.99% 80.39% 48.94% 98.71% 98.11% 95.85%
A complete phylogenetic analysis of nearly full-length data indicated that the Turkish strains grouped
with VG32/1 with good bootstrap value, while the Virulent B and GPV GER strains diverged from these
group, despite bearing high identities (Fig. 1).
3.3. Analysis of Structural Genomic Sequences
The structural ORF gene coding sequences were 2.199 nt in length and had 732 deduced amino acids.
Using the MUSCLE algorithm, we evaluated both the nucleotide and amino acid sequences, which
revealed that Yozgat19/TR and Corum19/TR were identical in the VP1 gene, whereas Konya19/TR was
relatively distant with a 99.91% nt identity. Virulent B (NC_001701) had the closest relationship to
Yozgat/19, Corum/19 and Konya/19 varying between 98.54% and 98.64% identity. VG32/1 (EU583392.1)
also presented higher identity with a percentage of 98.50–98.59%.
We compared both the nucleotide and predicted amino acid sequences of VP1 polyprotein sequences
with other available data. Konya/19 had only a single amino acid substitution—asparagine to aspartic
acid at the 703rd position (N703D) differentiating it from other Turkish strains. On the other hand, the
Turkish strains shared a series of amino acid substitution separating them from virulent B; these were
K47R, V144I, G177S, S498N Y521H, L529I, E558D and G615W. Most of these mutations were also
identi ed in the other European-originated strains, for instance, the VG32/1 and strain GPV GER
(KU684472.1). G177S substitution was detected in the partial genomic data of European-originated
strains, such as the D441/04 (DQ862008.1) and D462/1/04 (DQ862011.1) strains. Exceptions were
found for the S498N and N703D mutations, which were carried by strains detected in South Asia. Multiple
comparison analysis of VP1 protein was shown in Supplementary Fig. 3.
The phylogenetic analysis using the complete VP1 nucleotide sequences revealed that the Middle
Anatolian strains were grouped with the European-originated strains: virulent B (NC_001701.1), VG32/1
and the GPV GER with good bootstrap value (Fig. 2A). Despite having complete data for VP1, we
restricted our phylogenetic analysis of both 443 nt partial sequences of VP1/VP2 (Fragment A) and 495
nt partial sequences of VP3 gene (Fragment B) to include the partial genomic data of other European
Page 8/17originated strains. Phylogenetic analysis based on fragment A revealed that three Turkish strains
clustered with the Swedish strains (DQ862008 – DQ862012) in the European group 2, while the
Hungarian strains including virulent B strain fell into the European group 1 (Fig. 3A). Notably, The West-
European group included a highly pathogenic strain GPV-GER (KU684472) identi ed in ornamental ducks.
The SBDS-related group mostly consisting of French isolates (EU938702-EU938706; AY496906 and
AY496907) separated into a single branch with good bootstrap support value. This group presented high
identity to the Asian strains. On the other hand, fragment B-based analysis revealed a European cluster, in
which three Turkish strains generated a sub-branch (Fig. 3B). Notably, according to this analysis, strain
DB3 was the only Asian originated strain within the European genogroup again.
3.4 Analysis of Non-Structural Genomic Sequences
The 1884 bases and 627 derived amino acid sequencing data of the complete rep gene were elicited from
three Turkish strains. These data were used for multiple sequence alignments with other available
sequences to evaluate all of the synonymous and non-synonymous mutations. A multiple comparison
analysis demonstrated that the rep gene was highly conserved between strains; Konya/19 and Yozgat/19
were identical, whereas Corum/19 showed 99.04–99.36% nucleotide and amino acid similarity to them,
respectively. Konya/19 and Yozgat/19 were together distinguished from virulent B (NC_001701) by
serine-proline substitution at the 22nd residue (S22P) and a methionine-isoleucine substitution at the
575th residue (M575I). On the other hand, Corum/19 presented a series of unique mutations, —V153G,
Y157N, K550N and F572S— which were observed in neither GPV nor the MDPV strains. Multiple
comparison analysis of rep protein was shown in Supplementary Fig. 4.
Phylogenetic analysis of the nucleotide sequences showed that Turkish strains sub-clustered in a group
that included an Asian-originated DY strain (EF515837.1) and also a European strain, VG32/1
(EU583392.1). Notably, there was a weak delineation between the Asian and European strains as
observed in the VP1 based phylogeny (Fig. 2B).
3.5 Recombination and Molecular Evolution Analyses
To detect potential recombination events, seven available tests using RDP4 software were implemented
on nearly full-length genomes, structural and non-structural complete genomes and fragment A and
fragment B individually. We could not nd any possible recombination events for the obtained Middle
Anatolian strains.
We further calculated the dN/dS ratio to investigate the mode and strength of selection on parvoviral
genomes using VP1 and rep gene coding sequences. The results showed that overall dN/dS ratios were
below one for both coding sequences (0.209 for VP1 and 0.207 for rep) indicating negative selection.
4. Discussion
In 2019, multiple Derzsy’s disease cases occurred in geese farms located in various provinces in Turkey.
In this study, we aimed to detect the presence of goose parvovirus infection in Turkish geese farms and
Page 9/17contribute to the understanding of the epizootiology of this virus. For this purpose, we diagnosed the
disease based on clinical and necropsy ndings and performed conventional PCR by using our novel
primer set. We identi ed the GPV from both infected egg and the tissue samples retrieved from goose
ocks. Having con rmed the disease, we sought to perform molecular characterization of the viral
genome, including structural and non-structural genes. A recent retrospective study also revealed an
outbreak during 2018 in this area, which was in accordance with our ndings [29].
Zadori et al. (1995) previously de ned a primer set for the VP3 position [8], which has been extensively
used to identify and classify GPV elsewhere [6, 30, 31]. Since then, additional methods have been
developed such as Real Time PCR [32], LAMP [33] and immunochromatographic assay [34]. We de ned a
novel degenerated primer set for the detection of GPV amplifying VP3 coding sequence. Since we
con rmed that our novel degenerated primer set matched most of the retrieved sequence data, it might
also be considered as simple alternative approach for diagnostic purposes.
Both nearly full-length and VP1 coding sequence and data were individually utilized for phylogenetic
analysis to evaluate initial results from partial genomic data. These two analyses showed that our eld
strains clustered with European-originated strains and vaccine strains. VG32/1 and virulent B strains
have been utilized as parental vaccine strains in Asian and European countries, respectively [6, 35]. The
structural genes of GPV is highly stable in the environment and has presented only a 0.3% variation rate
in the past 20 years [36]. Furthermore, these variations accumulate mostly in the C-terminus of VP1,
where the VP3 gene is located. We subsequently implemented a series of phylogenetic analyses based on
VP1-VP2 fragment A (443 bp) and partial VP3 fragment B (495 bp) coding sequences. Fragment A region
is a well-conserved region and is frequently used for classi cation [13, 16]. Our fragment A-based
phylogenic analysis showed that eld strains had the closest relationship with European group 2, which
consisted of Swedish strains (DQ862008-DQ862012) [20]. Apart from this group, two more groups
occurred in the European cluster according to fragment A: Hungarian strains and Low pathogenic strains
and vaccines. Next, we performed phylogenetic analysis using 495 nt partial “fragment B” sequence data,
which revealed that the Minor Asian strains were similarly clustered with European strains in a single
genogroup. Notably, several European strains sub-branched together with Cherry duck-associated GPV
strains. Since we did not detect any recombinant events between strains, our ndings evidenced the
existence of endemic goose parvovirus strains that are analogous to European strains, speci cally to
Swedish strains (European group 2), circulating in geese ocks in the Middle Anatolian regions. These
results suggested that the nearly-complete genomic data based phylogeny method allowed more detailed
classi cation results, since it gave unambiguously better contrasts within European strains and exhibited
signi cant diversity than the genomic sequences. Thus, we particularly recommend analyzing full data in
molecular epidemiology studies of goose parvovirus. In this point, our developed primer sets were broader
in range and therefore might be good alternative for genomic investigation.
Mutations in the nucleotides and predicted amino acid sequences of VP1 were investigated and analyzed
according to available data in GenBank. We detected several substitution mutations in the coding
sequence homogeneously distributed between the N- and C- terminus halves of VP1; however, non-
Page 10/17synonymous mutations were predominantly on the VP3. The C- terminus part of VP1 overlaps with VP2
and VP3 and is considered to be a determinant for GPV assembly and attenuation [36]. Eight mutual
amino acid variations were shared between the Turkish eld strains and several Asian-originated strains.
N706D was unique for Konya/19 and, is also one of the nine substitutions that distinguish the vaccine
and wild type of the 82–0321 strain (EU583390.1) [36]; It is still common in with some of eld strains in
Asia. On the other hand, the structural genes of GPV include several motifs and regions altering the
pathogenesis such as the nuclear import motif [37] or the VP1–VP2 cleavage motif [36, 38]. Additionally,
Yu et al. (2012) identi ed seven immunodominant regions (IDs) on the structural proteins of GPV [39]. In
the present study, no mutation was detected on the known motifs, which could relate to virulence.
However, K47R, G177S and E558D substitutions were found on the ID1, ID2 and ID3, respectively. In
addition, ve amino acid substitutions (S498N, Y521H, L529I, E558D and G615W) were detected between
the 478th and the 623rd aa residue in the VP1 gene, where the receptor binding site (RBS) is positioned
[31]. Genetic diversity between the structural genes of parental and vaccine strains were predominantly
accumulated in this motif as well. These results together proved the competent GPV strains with
distinctive variations on the surface protein-coding genes. Thus, the immunogenic features of Minor
Asian eld strains deserve to be comparatively assessed.
The rep protein of GPV is a nuclear phosphoprotein (NS), and owing to its structural domains, has
multifunctional features including target-speci c DNA binding, endonuclease and helicase [40]. Our
multiple comparison analysis demonstrated a series of synonymous and non-synonymous mutations
through NS coding sequences of goose parvovirus. We brie y detected six mutations in total; however,
four of them (V153G, Y157N, K550N and F572S) were unique in Corum/19. The two remaining mutations
—S22P and M575I—are shared with Asian-originated strains. Previously, immunodominant regions were
de ned on the C-terminus of the deduced amino acid sequences [41, 42]. Despite the fact that we could
not detect any amino acid substitution on the functional motifs, K550N, F572S and M575I were observed
in the epitope-coding sequences of the rep gene. The rst two of these substitutions were in Corum/19,
while the latter was found in all the Turkish strains. On the other hand, comprehensive recombination
analysis did not address any events between the Turkish strains and other known GPV, MDPV and avian
adeno-associated virus genomes. Taken together, we concluded the existence of European-classi ed GPV
strains with low levels of diversity causing infections in the Middle Anatolia.
The evolutionary relationship between GPV strains and other known strains was also analyzed according
to the complete sequences of the rep gene. Phylogenetic analysis demonstrated that the Turkish strains
were closely related to both DY (EF515837.1) and the VG32/1 (EU583392.1) strains, which were isolated
in China and Europe, respectively. Wan et al., (2015) suggested that the DY strain was a recombinant
strain, which was also con rmed by our recombination detection analyses [43]. However, no
recombination events were detected between Middle Anatolian and DY strains. Notably, nonstructural
gene-based phylogeny revealed the heterogeneity between genogroups regarding the origins of the
strains, which seemed to contradict VP1 phylogeny.
Page 11/17We looked for recombination events in the genomic data by limiting the capability of the RDP4 software.
Our ndings indicated no evidence of recombination in the Turkish strains. Recombinant GPV strains with
GPV and MDPV ancestors have been reported elsewhere [44, 45]. The results of our bioinformatic
analysis demonstrated again the newly emerged variants, which con rmed the validity of our approach.
However, unidenti ed GPV and MDPV strains could potentially have contributed to the evolution of Minor
Asian strains; therefore, further studies are required.
We calculated the dN/dS ratio for structural and nonstructural genes as 0.209 and 0.207, respectively.
This ratio is considered to be an indicator re ecting the selective pressure on the coding sequences [46]
and, in our case, the results pointed to negative selection. Evidence of strong negative selection has
previously been reported in the gene coding sequences of other parvoviruses (e.g. parvovirus B19 [47] and
canine parvovirus [48]). As the ratio of both genes was closer, we conjectured that the evolutional
mechanisms might affect at the same rate for both genes. However, multiple factors contribute to viral
evolution; therefore, the dN/dS ratio calculation alone may not be an appropriate method to infer
selection pressures [49]. Indeed, further data must be generated for the non-structural genes from the
European strains to validate this hypothesis.
We are aware that this study has a few limitations that might impact our ndings. First, the collection of
specimens was performed from some of the Turkish provinces where the disease reported. Thus, our
limited number of samples obviously could not represent the whole Anatolian territory. The second, only a
few numbers of sequencing data have been characterized from Europe, most of which depend on the
partial sequences of VP1 only. These limitations underlined the need for more comprehensive studies in
both Turkey and Europe.
In conclusion, in this study we focused on a the Derzsy’s disease outbreak in geese ocks in several
provinces in Turkey. We evidenced European strain-related, virulent variants of GPV circulating in the
territory of Asia Minor. This study also comparatively assessed the complete structural and non-structural
speci cations of goose parvovirus strains from an outbreak with multiple foci. Multiple sequence
comparison and phylogenetic analysis of the obtained eld strains demonstrated the existence of
genetically related and authentic strains with unique mutations. These results provided substantial data
to determine the basic characteristics and geographical distribution of variants between Asia and Europe.
Furthermore, phylogenetic analyses based on the partial sequence of structural genes demonstrated the
genome constellation of local strains, while complete genomic analyses proved this methodology to be
accurate. We inferred that the VP1-VP2 and VP3 sequences would allow the researchers su cient data to
classify GPV.
COMPLIANCE
This article does not contain any studies with human or animal subjects performed by any of the authors.
The authors declare that they have no con ict of interest.
Page 12/17Abbreviations
BLAST
Basic Local Alignment Search Tool
dN
non-synonymous mutation
dS
synonymous mutation
GPV
goose parvovirus
ITR
Inverted Terminal Repeat
MDPV
Muscovy duck parvovirus
MUSCLE
Multiple Sequence Comparison by Log- Expectation.
MSA
Multiple Sequence Alignment
NS
non-structural
PCR
Polymerase Chain Reaction
Rep
Replication
RBE
Ribosome Binding Element
SBDS
Short beak and dwar sm syndrome
USA
United States of America
VP
Viral Protein
Declarations
ACKNOWLEDGEMENTS
This study did not receive any nancial support.
References
Page 13/171. Woolcock PR (2013) Viral Infections of Waterfowl. In: Diseases of Poultry. Wiley, pp 417–463
2. Nagy Z, Derzsy D (1968) A viral disease of goslings. II. Microscopic lesions. Acta Vet Acad Sci Hung
18:3–17
3. Cotmore SF, Agbandje-McKenna M, Canuti M, et al (2019) ICTV virus taxonomy pro le: Parvoviridae.
J Gen Virol 100:367–368. https://doi.org/10.1099/jgv.0.001212
4. Bian G, Ma H, Luo M, et al (2019) Identi cation and genomic analysis of two novel duck-origin GPV-
related parvovirus in China. BMC Vet Res 15:1–10. https://doi.org/10.1186/s12917-019-1833-9
5. Parrish CR (2011) Parvoviridae. In: Fenner’s Veterinary Virology. Elsevier, pp 225–235
6. Tatár-kis T, Mató T, Markos B, Palya V (2004) Phylogenetic analysis of Hungarian goose parvovirus
isolates and vaccine strains. Avian Pathol 33:438–444.
https://doi.org/10.1080/03079450410001724067
7. Le Gall-Reculé G, Jestin V (1994) Biochemical and genomic characterization of muscovy duck
parvovirus. Arch Virol 139:121–131. https://doi.org/10.1007/BF01309459
8. Zádori Z, Stefancsik R, Rauch T, Kisary J (1995) Analysis of the Complete Nucleotide Sequences of
Goose and Muscovy Duck Pervoviruses Indicates Common Ancestral Origin with Adeno-Associated
Virus 2. Virology 212:562–573. https://doi.org/10.1006/viro.1995.1514
9. Zádori Z, Erdei J, Nagy J, Kisary J (1994) Characteristics of the genome of goose parvovirus. Avian
Pathol 23:359–364. https://doi.org/10.1080/03079459408419004
10. Schettler CH (1971) Virus Hepatitis of Geese II. Host Range of Goose Hepatitis Virus. Avian Dis
15:809. https://doi.org/10.2307/1588871
11. Schettler CH (1971) GOOSE VIRUS HEPATITIS IN THE CANADA GOOSE AND SNOW GOOSE. J Wildl
Dis 7:147–148. https://doi.org/10.7589/0090-3558-7.3.147
12. Glávits R, Zolnai A, Szabó É, et al (2005) Comparative pathological studies on domestic geese (Anser
Anser Domestica) and muscovy ducks (Cairina Moschata) experimentally infected with parvovirus
strains of goose and muscovy duck origin. Acta Vet Hung 53:73–89.
https://doi.org/10.1556/AVet.53.2005.1.8
13. Stoute ST, Tsai H, Metwally SA, et al (2020) Viral Infections of Waterfowl. In: Diseases of Poultry.
Wiley, pp 446–497
14. Palya V, Zolnai A, Benyeda Z, et al (2009) Short beak and dwar sm syndrome of mule duck is caused
by a distinct lineage of goose parvovirus. Avian Pathol 38:175–180.
https://doi.org/10.1080/03079450902737839
15. Ning K, Liang T, Wang M, et al (2017) Genetic detection and characterization of goose parvovirus:
Implications for epidemiology and pathogenicity in Cherry Valley Pekin ducks. Infect Genet Evol
51:101–103. https://doi.org/10.1016/j.meegid.2017.03.024
16. Ning K, Liang T, Wang M, et al (2018) Pathogenicity of a variant goose parvovirus, from short beak
and dwar sm syndrome of Pekin ducks, in goose embryos and goslings. Avian Pathol 47:391–399.
https://doi.org/10.1080/03079457.2018.1459040
Page 14/1717. Hlinak A, Müller T, Kramer M, et al (1998) Serological survey of viral pathogens in bean and white-
fronted geese from Germany. J Wildl Dis 34:479–486. https://doi.org/10.7589/0090-3558-34.3.479
18. Irvine R, Ceeraz V, Cox B, et al (2008) Goose parvovirus in Great Britain. Vet Rec 163:461.
https://doi.org/10.1136/vr.163.15.461
19. Wozniakowski G (2009) Genetic variance of Derzsy�s disease strains isolated in Poland. J Mol
Genet Med 03:210–216. https://doi.org/10.4172/1747-0862.1000037
20. Jansson DS, Feinstein R, Kardi V, et al (2007) Epidemiologic Investigation of an Outbreak of Goose
Parvovirus Infection in Sweden. Avian Dis Dig 2:e18–e18. https://doi.org/10.1637/0005-
2086(2007)51[609:EIOAOO]2.0.CO;2
21. Edgar RC (2004) MUSCLE: A multiple sequence alignment method with reduced time and space
complexity. BMC Bioinformatics 5:1–19. https://doi.org/10.1186/1471-2105-5-113
22. Kearse M, Moir R, Wilson A, et al (2012) Geneious Basic: An integrated and extendable desktop
software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–
1649. https://doi.org/10.1093/bioinformatics/bts199
23. Sterky F, Lundeberg J (2000) Sequence analysis of genes and genomes. J Biotechnol 76:1–31.
https://doi.org/10.1016/S0168-1656(99)00176-5
24. Sievers F, Higgins DG (2018) Clustal Omega for making accurate alignments of many protein
sequences. Protein Sci 27:135–145. https://doi.org/10.1002/pro.3290
25. Kumar S, Stecher G, Li M, et al (2018) MEGA X: Molecular evolutionary genetics analysis across
computing platforms. Mol Biol Evol 35:1547–1549. https://doi.org/10.1093/molbev/msy096
26. Martin DP, Murrell B, Golden M, et al (2015) RDP4: Detection and analysis of recombination patterns
in virus genomes. Virus Evol 1:1–5. https://doi.org/10.1093/ve/vev003
27. Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0
for Bigger Datasets. Mol Biol Evol 33:1870–1874. https://doi.org/10.1093/molbev/msw054
28. Guindon S, Dufayard JF, Lefort V, et al (2010) New algorithms and methods to estimate maximum-
likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst Biol 59:307–321.
https://doi.org/10.1093/sysbio/syq010
29. Kardoğan Ö, Müştak HK, Müştak İB (2021) The rst detection and characterization of goose
parvovirus (GPV) in Turkey. Trop Anim Health Prod 53:. https://doi.org/10.1007/s11250-020-02463-8
30. Poonia B, Dunn P, Lu H, et al (2006) Isolation and molecular characterization of a new Muscovy duck
parvovirus from Muscovy ducks in the USA. Avian Pathol 35:435–441.
https://doi.org/10.1080/03079450601009563
31. Shien J-H, Wang Y-S, Chen C-H, et al (2008) Identi cation of sequence changes in live attenuated
goose parvovirus vaccine strains developed in Asia and Europe. Avian Pathol 37:499–505.
https://doi.org/10.1080/03079450802356979
32. Wan C, Chen C, Cheng L, et al (2019) Speci c detection and differentiation of classic goose
parvovirus and novel goose parvovirus by TaqMan real-time PCR assay, coupled with host speci city.
Page 15/17BMC Vet Res 15:1–8. https://doi.org/10.1186/s12917-019-2090-7
33. Jinlong Y, Rui Y, Anchun C, et al (2010) A simple and rapid method for detection of Goose Parvovirus
in the eld by loop-mediated isothermal ampli cation. Virol J 7:2–8. https://doi.org/10.1186/1743-
422X-7-14
34. Yu X, Wei L, Chen H, et al (2018) Development of colloidal gold-based immunochromatographic
assay for rapid detection of goose parvovirus. Front Microbiol 9:1–7.
https://doi.org/10.3389/fmicb.2018.00953
35. Chang PC, Shien JH, Wang MS, Shieh HK (2000) Phylogenetic analysis of parvoviruses isolated in
Taiwan from ducks and geese. Avian Pathol 29:45–49. https://doi.org/10.1080/03079450094270
36. Tsai H-J, Tseng C-H, Chang P-C, et al (2004) Genetic Variation of Viral Protein 1 Genes of Field
Strains of Waterfowl Parvoviruses and Their Attenuated Derivatives. Avian Dis 48:512–521.
https://doi.org/10.1637/7172
37. Chen S, Liu P, He Y, et al (2018) The 164 K, 165 K and 167 K residues in 160YPVVKKPKLTEE171 are
required for the nuclear import of goose parvovirus VP1. Virology 519:17–22.
https://doi.org/10.1016/j.virol.2018.03.020
38. Tu M, Liu F, Chen S, et al (2015) Role of capsid proteins in parvoviruses infection. Virol J 12:.
https://doi.org/10.1186/s12985-015-0344-y
39. Yu TF, Ma B, Gao MC, Wang JW (2012) Localization of linear B-cell epitopes on goose parvovirus
structural protein. Vet Immunol Immunopathol 145:522–526.
https://doi.org/10.1016/j.vetimm.2011.11.022
40. Cotmore SF, Agbandje-McKenna M, Chiorini JA, et al (2014) The family Parvoviridae. Arch Virol
159:1239–1247. https://doi.org/10.1007/s00705-013-1914-1
41. Yu T fei, Ma B, Wang J wei (2016) Identi cation of linear B-cell epitopes on goose parvovirus non-
structural protein. Vet Immunol Immunopathol 179:85–88.
https://doi.org/10.1016/j.vetimm.2016.08.009
42. Qiu Z, Tian W, Yu T, et al (2012) Monoclonal antibodies against NS1 protein of goose parvovirus.
Hybridoma 31:125–130. https://doi.org/10.1089/hyb.2011.0098
43. WAN C, CHEN H, FU Q, et al (2015) Genomic Characterization of Goose Parvovirus and Muscovy
Duck Parvovirus Co-infection in Fujian, China. Kafkas Univ Vet Fak Derg 21:923–928.
https://doi.org/10.9775/kvfd.2015.13848
44. Liu W jun, Yang Y tian, Zou H yin, et al (2020) Identi cation of recombination in novel goose
parvovirus isolated from domesticated Jing-Xi partridge ducks in South China. Virus Genes 56:600–
609. https://doi.org/10.1007/s11262-020-01781-1
45. Wang J, Ling J, Wang Z, et al (2017) Molecular characterization of a novel Muscovy duck parvovirus
isolate: Evidence of recombination between classical MDPV and goose parvovirus strains. BMC Vet
Res 13:1–10. https://doi.org/10.1186/s12917-017-1238-6
46. Yang Z, Bielawski JR (2000) Statistical methods for detecting molecular adaptation. Trends Ecol
Evol 15:496–503. https://doi.org/10.1016/S0169-5347(00)01994-7
Page 16/1747. Stamenković GG, Ćirković VS, Šiljić MM, et al (2016) Substitution rate and natural selection in
parvovirus B19. Sci Rep 6:35759. https://doi.org/10.1038/srep35759
48. Battilani M, Scagliarini A, Ciulli S, et al (2006) High genetic diversity of the VP2 gene of a canine
parvovirus strain detected in a domestic cat. Virology 352:22–26.
https://doi.org/10.1016/j.virol.2006.06.002
49. Kryazhimskiy S, Plotkin JB (2008) The population genetics of dN/dS. PLoS Genet 4:.
https://doi.org/10.1371/journal.pgen.1000304
Page 17/17You can also read
