Supplemental Information Multifactorial Induction of an Orphan PKS-NRPS Gene Cluster in Aspergillus terreus
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Chemistry & Biology 18
Supplemental Information
Multifactorial Induction of an Orphan
PKS-NRPS Gene Cluster in Aspergillus terreus
Markus Gressler, Christoph Zaehle, Kirstin Scherlach, Christian Hertweck, and
Matthias Brock
ketosynthase (KS)
acyltransferase (AT)
1dehydratase (DH)
acyl carrier protein (ACP)
reduction domain (R/C)
2Figure S1, related to Figure 1A. Alignment of the A. terreus PKS-NRPS (ATEG_00325)
protein sequence with those from other PKS-NRPS hybrids
Sequences were aligned using ClustelW algorithm (Megalign DNAstar Lasergene Vers.
7.2.1). Areas marked in black indicate identical amino acids. The potential dehydratase
contains the proposed active site residues, but the domain seems not to be used. In contrast, no
active site residues for the predicted methyltransferase and ketoreductase are present.
Conserved domains are highlighted by blue bars. Red squares indicate the conserved
NADH/NADPH binding site. Blue arrows highlight the positions of the short chain
dehydrogenase/reductase (SDR) catalytic triad (serine-tyrosine-lysine). The black dots
indicate conserved polar amino acid residues that distinguish SDRs from other redox active
domains.
Figure S2, related to Figure 1B. Comparative metabolite profiling of Aspergillus terreus
from different culture conditions
Culture filtrates of SBUG844 wild type (wt), SBUG844/akuB and SBUG844/akuB/00325
in minimal glucose (G50), YPD and Czapek (CYA) medium were analyzed. HPLC analyses
revealed no isoflavipucine and dihydroisoflavipucine production. HPLC profiles are shown
with detection at 254 nm. Nitrogen detection revealed no signals in the selected area (not
shown).
3Figure S3, related to Figure 2. Metabolite profiling of strains A1156, A1165/akuB, and
A1156/akuB/00325 from casamino acid (CA) containing medium and YPD
(A) HPLC-UV profiles at 254 nm.(B) HPLC profiles with nitrogen detection. (C) Complete
HPLC-UV profiles at 254 nm. Asterisks indicate peaks, which were also observed by mass
spectrometry in strain A1165/akuB, but hardly showed up in the UV spectrum. Neither one
of both peaks showed any nitrogen signal, indicating that these metabolites are not related to
the PKS-NRPS gene cluster investigated in this study. This figure is supplementary to Figure
2.
4Figure S4, related to Table 1. Semiquantitative reverse transcription PCR for
investigating the expression of genes from the PKS-NRPS hybrid gene cluster
Actin was used as a control for standardization of cDNAs (30 cycles of amplification). All
other PCR reactions were performed by using 35 amplification cycles. Genomic DNA
(gDNA) always served as a positive control. Lanes marked by “+” are assumed to belong to
the gene cluster. (A) PCR on cDNA of SBUG844 wild type grown under non-inducing
(G100) or inducing conditions (CA1%) for 24 and 48 hours. (B) PCR on cDNA of the
reporter strain SBUG844_P00325:lacZ (R)and the ATEG00326 overexpression strain
SBUG844_P00325:lacZ_PagaA:00326 (OE). Strains were grown for 48 hours on arginine as
sole nutrient source. (C) Oligonucleotides used for the amplification of the respective gene.
The controlled overexpression of the transcription factor ATEG00326 leads to virtually the
same expression pattern as observed under naturally inducing conditions. Especially
ATEG00325, 00326, 00329, 00330, and 00331 seem to belong to the cluster. The putative
elongation factor 1 (ATEG00321; see also Table S1) seems also controlled by ATEG00326
expression. However, under naturally inducing conditions (CA), only a weak band is observed
after 48 h of growth.
5A
B
6C
D
7E
F
8G
H
9I
Figure S5, related to Figures 2B and 6A.. Spectra from 1H-NMR, 13C-NMR and HMBC
experiments for structure analysis of isoflavipucine and dihydroisoflavipucine
Spectra of isoflavipucine were recorded at 600 MHz for proton and 150 MHz for carbon,
whereas for dihydroisoflavipucine proton spectra were recorded at 500 MHz and for carbon
spectra at 125 MHz. In all experiments DMSO-d6 was used as solvent and internal standard.
The corresponding structures (1; 2a; 2b) can be found in Table S2. (A) 1H-NMR spectrum of
isoflavipucine (1) (B) 13C-NMR spectrum of isoflavipucine (1) (C) 13C-NMR spectrum of
purified isoflavipucine (1) from feeding experiment with [1-13C] L-leucine (D) HMBC
spectrum of isoflavipucine (1) (E) 1H-NMR spectrum of dihydroisoflavipucine (2a) (F) 13C-
NMR spectrum of dihydroisoflavipucine (2a) (G) 1H-NMR spectrum of dihydroisoflavipucine
(2b) (H) 13C-NMR spectrum of dihydroisoflavipucine (2b) (I) HMBC spectrum of
dihydroisoflavipucine (2b)
Figure S6, related to Figures 2B and 6A.. Chiral stationary phase chromatography.
A Phenomenex lux cellulose 2 column was used for the separation of all four dihydroiso-
flavipucine stereoisomers. Detection was carried out at 254 nm.
1011
Figure S7, related to all main text figures. Sequence alignments for determination of
phylogenetic relation of A. terreus SBUG844 with type strains
(A) Comparison of the internal transcribed spacer regions 1 and 2 (ITS1 and 2) between the A.
terreus reference strain ATCC16792 (Henry et al., 2000) (accession: AF138290), strain
A1156 from the A. terreus genome sequencing project (accession: HQ380176), and strain
SBUG844 (accession: HQ380177). The ITS1-5.8S-ITS2 sequences were amplified with
oligonucleotides P31 and P32 (see Table S3). Sequences coding for ribosomal RNAs are
12highlighted in gray. Differences between the three sequences were only observed in ITS2, in
which strain SBUG844 showed three transversions (CTC to GAG; boxed). (B) Alignment of
DNA regions upstream the translational start ATG of ATEG00325 between strains A1156
and SBUG844 (accession: HQ380178). The upstream region from SBUG844 was amplified
with oligonucleotides P23 and P24 (see Table S3) and compared to the genomic sequence of
strain A1156
(http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html). The
translational start point of ATEG00325 is shown in gray. The upstream-untranslated regions
of both strains differ in five base transitions (boxed). None of these transitions affect one of
the putative regulatory target sequences for CreA, PacC or AreA.
13Figure S8, related to figures 1-5 and Table 1. Southern blot analyses of transformants
generated in this study
Digoxigenin-labeled probes were used in hybridizations with target sequences and signals
were detected with CDPstar (Roche Diagnostics). (A) Schematic presentation of the genomic
situation of the ATEG00325 locus in wild-type strains (in respect to ATEG00325; A1156,
A1156/akuB, and SBUG844/akuB) and partial ATEG00325 deletion mutants. (PTR)
denotes the pyrithiamine resistance cassette. PstI restriction leads to an expected 1662 bp
fragment in wild-type strains and a 4003 bp fragment in partial deletion mutants. The probe
directed against the upstream region of ATEG00325 was amplified with oligonucleotides P11
and P12 (see Table S3). (B - D) Southern blot analyses for confirmation of partial gene
deletion in (B) A. terreus strain A1156 (C) A. terreus strain SBUG844/akuB strain (D) A.
terreus strain A1156/akuB. X denotes strains that were used for subsequent analyses. (E)
Southern blot for screening for the integration number of the PgpdA:ATEG00326 fusion into
the genome of A. terreus strain SBUG844 (wt). DNA was restricted with SalI and KpnI and a
probe directed against the pyrithiamine resistance cassette was used (P33 and P34; Table S3).
(F) Southern blot for screening for the integration number of the ATEG00325 promoter:lacZ
fusion into the genome of A. terreus strain SBUG844 (wt). Genomic DNA was restricted with
SalI and HindIII and a probe directed against the lacZ gene was used (P25 and P26). Strain
SBUG844/P00325:lacZ contains a single integration of the reporter construct. (G) Southern
blot for screening for the integration number of the arginase promoter (PagaA) fusion with the
lacZ gene within the genome of A. terreus strain SBUG844 (wt). Genomic DNA was
restricted with SalI and HindIII. Strain A. terreus SBUG844/PagaA:lacZ contains a single
integration of the reporter construct. A probe directed against the lacZ gene was used (P25
and P26). (H) Southern blot for screening for the integration number of the fusion of the agaA
14promoter (PagaA) with ATEG00326 into the genome of the reporter strain
SBUG844/P00325:lacZ. Genomic DNA was restricted with KpnI and HindIII and a probe
directed against the hygromycine resistance cassette (hph) was used (P35 and P36). The strain
SBUG844/P00325:lacZ/PagaA:00326 contains a single copy integration of the construct.
15Table S1, related to Figure 1. Deduced protein functions encoded by the PKS-NRPS gene
cluster and closest relatives. Genes predicted to belong to the cluster by SMURF analysis are
highlighted in gray.
16Table S2. 13C and 1H-NMR data for isoflavipucine (1x) and dihydroisoflavipucine
diastereomers (2a/by)
key HMBC
COSY
No. 13
C 1H (ppm) 13
C 1H (ppm) 13
C 1H (ppm)
(ppm) JHH [Hz] (ppm) JHH [Hz] (ppm) JHH [Hz]
1-NH 11.78 (s, 1H) 11.49 (s, 1H) 11.55 (s, 1H)
2 152.7 152.8 152.2
3 129.5 130.6 130.7
4 153.4 154.0 154.1
5 91.8 6.17 (s, 1H) 91.8 5.99 (s, 1H) 91.9 6.05 (s, 1H)
6 142.9 141.4 141.4
7 106.1 6.44 (s, 1H) 113.4 5.95 (d, 1H, 3.4) 113.4 6.00 (d, 1H, 3.4)
8 202.0 68.1 3.69 (m, 1H) 68.2 3.74 (m, 1H)
9 45.5 2.57 (d, 2H, 6.7) 39.3 1.39 (m, 1H); 39.3 1.44 (m, 1H);
1.20 (m, 1H) 1.24 (m, 1H)
10 23.4 2.09 (m, 1H) 23.7 1.79 (m, 1H) 23.7 1.84 (m, 1H)
11 22.3 0.91 (d, 3H, 6.7) 23.4 0.90 (d, 3H, 6.7) 23.5 0.89 (d, 3H, 6.7)
12 22.3 0.90 (d, 3H, 6.7) 21.3 0.85 (d, 3H, 6.7) 21.4 0.84 (d, 3H, 6.7)
13 18.6 2.19 (s, 3H) 18.5 2.13 (s, 3H) 18.5 2.17 (s, 3H)
8-OH 5.22 (br s, 1H) 5.28 (d, 1H, 6.4)
x
Spectra were recorded at 600 MHz for proton and 150 MHz for carbon in DMSO-d6
y
Spectra were recorded at 500 MHz for proton and 125 MHz for carbon in DMSO-d6
17Table S3. Detailed listing of chemicals and materials used in this study.
Company (business address) Chemicals/Materials
Applichem L-arginine, L-citrulline, D-fructose, D-mannose, L-ornithine
(Darmstadt, Germany) hydrochloride, peptone from casein, D-ribose, saccharose, L-
serine, yeast extract
Applied Biosystems TURBO DNA-free Kit
(Darmstadt, Germany)
Agilent Technologies Agilent 1100 Series with MSD trap, Zorbax Eclipse XDB C8
(Waldbronn, Germany) (150 4.6 mm; 5 µm)
Analytik Jena FlexCycler, Speedcycler
(Jena, Germany)
B. Braun international Biostat MD 5
(now: Sartorius Stedim biotech)
(Goettingen, Germany)
BD Bioscience BD Falcon Cell strainer 40 µm Nylon
(Heidelberg, Germany)
Bioline Accuzyme DNA Polymerase, TRIsure
(Luckenwalde, Germany)
Biomol glycine, beta-nicotinamid-adenin-dinucleotide (reduced form)
(Hamburg, Germany)
BioRad Laboratories Universal HOOD II, Bradford reagent
(Munich, Germany)
Bruker Biospin Bruker Avance III 500 Mhz, Bruker Avance III 600 Mhz, Bruker
(Rheinstetten, Germany) Topsin 2.1 software
Cambridge Isotope Laboratories [1-13C]L-leucine, [5-2H3]L-leucine
(Saarbruecken, Germany)
Carl Roth D-sorbit, X-Gal
(Karlsruhe, Germany)
Epicentre MasterPure Yeast DNA extraction kit
(Madison, WI, USA)
Fermentas CloneJET PCR Cloning Kit, FastDigest endonucleases, Rapid
(St. Leon-Rot, Germany) DNA Ligation Kit
Finnzymes PhusionHot Start High-Fidelity DNA Polymerase
(Espoo, Finland)
Invitrogen select agar, Superscript III Reverse Transcriptase Kit
(Darmstadt, Germany)
Janke & Kunkel IKA Ultra-Turrax-Antrieb T25
(Staufen, Germany)
Macherey-Nagel NucleoSpin Plasmid Kit
(Dueren, Germany)
Merck L-asparagine, L-aspartate, chloroform, dichloromethane, DMSO
18(Darmstadt, Germany) for NMR, ethanol, ethyl acetate, methanol, Miracloth, L-
phenylalanine, L-threonine, L-tyrosine, urea
MP biomedicals casamino acids
(Illkirch, France)
Perkin Elmer Ltd. Lambda 25 UV/VIS
(Beaconsfield, UK)
Phenomenex Phenomenex Lux Cellulose 2 (250 4.6 mm; 5 µm)
(Aschaffenburg, Germany)
Roche Digoxigenin-11-dUTP, Hygromycine B
(Mannheim, Germany)
Sartorius Minisart RC4 filter
(Goettingen, Germany)
Serva Electrophoresis MOPS
(Heidelberg, Germany)
Sigma Aldrich adenosine diphosphate, proteinogenic amino acids, D-(+) glucose
(Hamburg, Germany) monohydrate, beta-mercaptoethanol, o-nitrophenyl beta-D-
galactopyranoside, L-glutamate dehydrogenase from bovine liver
(type II), olive oil, 2-oxoglutarate, potato dextrose broth, potato
extract, pyrithiamine hydrobromide, Sabouraud dextrose broth,
urease from Canavalia ensiformis
Thermo Scientific Accela UPLC with exactive mass spectrometer, Betasil C18
(Dreieich, Germany) (150 2.1 mm; 3 µm)
VWR international n-heptane
(Darmstadt, Germany)
Waters Waters autopurification system, Waters X-terra prep MS C18
(Eschborn, Germany) (50 19 mm; 5 µm)
Table S4. Oligonucleotides used in this study. Restriction sites in oligonucleotide sequences
are underlined.
No. Name 5´-3´ sequence Utilized for
P1 act_Ater_for CCATCGAGAAGTCTTATGAGC semiquantitative RT-PCR (actin)
P2 act_Ater_rev GGACAGGGAAGCCAGAATGG semiquantitative RT-PCR (actin)
P3 ATEG_00325_for1 CTTTCACGGTCAATCTCCTTCG semiquantitative RT-PCR (ATEG00325)
P4 ATEG_00325_rev1 CAGAGTCTGGCTTGTTGTGC semiquantitative RT-PCR (ATEG00325)
P5 ATEG_00325_for2 GCTCTGGATGTCTCACTTCC semiquantitative RT-PCR (ATEG00325)
P6 ATEG_00325_rev2 CATTTGGCAGCCACGTAACC semiquantitative RT-PCR (ATEG00325)
P7 At00326_in_for GCTTAACGTCGACCTGTACG semiquantitative RT-PCR (ATEG00326)
P8 At00326_in_rev GACGATTTGCAACGAGGACG semiquantitative RT-PCR (ATEG00326)
P9 NB_AT00328_for GTCCCTAGATGATCTCTTGC semiquantitative RT-PCR (ATEG00328)
P10 At_00328in_rev GAGGATCAAAAGCAAACTGC semiquantitative RT-PCR (ATEG00328)
P11 SmaI_00325up_for CCCGGGAAGGTTGTTGGTGTG ATEG00325 5´ deletion flank
P12 NotI_00325up_rev CTGCTGTGCGGCCGCAACCAAGATGTGTCAAC ATEG00325 5´ deletion flank
P13 NotI_00325in_for CTTGGTTGCGGCCGCACAGCAGATGCAAGATAG ATEG00325 3´ deletion flank
19P14 SmaI_00325in_rev CCCGGGAGGTCTTTGACTAGCTTC ATEG00325 3´ deletion flank
P15 Bam_EcLacZ_f GGATCCACCATGATTACGGATTCACTGG lacZ reporter strains (lacZ)
P16 Nco_EcLacZ_r CCATGGCTATTTTTGACACCAGACCAACTG lacZ reporter strains (lacZ)
P17 Nco_AtTrpCTerm_f CCATGGCAGCAGTGATTTCAATCTGAACC lacZ reporter strains (trpC terminator)
P18 Hind_AtTrpCTerm_r AAGCTTGAGTGAGGGTTGAGTACGAG lacZ reporter strains (trpC terminator)
P19 AtPgpdA_Not_upf GCGGCCGCGCGCTTAAAGAATGTCACAGC lacZ reporter strains,
ATEG 00326 overexpression
(gpdA promoter)
P20 AtPgpdA_BGl_dor AGATCTCATTTGCTCTATTTATCTTGAACTG lacZ reporter strains,
ATEG 00326 overexpression
(gpdA promoter)
P21 NotI_AtPagaA_f GCGGCCGCTCATTGAACTGGAGG lacZ reporter strains,
ATEG 00326 overexpression
(agaA promoter)
P22 BamHI_AtPagaA_r GGATCCCATGGTGTGAGGTGGATGG lacZ reporter strains,
ATEG 00326 overexpression
(agaA promoter)
P23 Not_AtP00325_f GCGGCCGCTGATGTCACCTTGTCCG lacZ reporter strains
(ATEG00325 promoter)
P24 Bgl_AtP00325_r AGATCTCATCCTCGACGACGTGCAG lacZ reporter strains
(ATEG00325 promoter)
P25 LacZ_up_down GGCGTTACCCAACTTAATCGC probe lacZ
P26 LacZ_mitte_up CTCATCCATGACCTGACCATG probe lacZ
P27 pJET_vor_PstI_f CGAAAAGTGCCACCTGACG ATEG 00326 overexpression
(MCS of pJET1.2)
P28 pJET_vor_Hind_r GAATGCTGAGGAACTTGCAAAGC ATEG 00326 overexpression
(MCS of pJET1.2)
P29 BamHI_00326_in_fr GGATCCGCCAAACCCAACCAGCGC ATEG 00326 overexpression
(ATEG00326 with terminator)
P30 KpnI_00326Term_r GGTACCTTCCCGCTGTTCTCC ATEG 00326 overexpression
(ATEG00326 with terminator)
P31 Aspergill-ITS1 TCCGTAGGTGAACCTGCGG ITS sequencing (18S rDNA)
P32 Aspergill-ITS4 TCCTCCGCTTATTGATATG ITS sequencing (28S rDNA)
P33 ptrA_for ATGTCTCCTCCAGCTGCCATC probe ptrA
P34 ptrA_rev CGGGTAGTGAGTCATTTA C probe ptrA
P35 hph_for CGATGTAGGAGGGCGTGGATA probe hph
P36 hph_rev GCTTCTGCGGGCGATTTGTGT probe hph
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
Culture conditions for large scale fermentation
Optimized large-scale fermentation of strain A. terreus SBUG844 was performed in a
4 L Biostat MD 5 fermenter (B. Braun Biotech international) containing AMM with 1%
casamino acids. The medium was inoculated with 2 106 conidia/mL and cells were grown
for 72 h at 30°C under constant stirring (500 rpm). The pH value was constantly monitored
and maintained at pH 8 by the addition of 10% sulfuric acid. Samples were taken after 24, 36,
48 and 72 h and product formation was determined from the culture extracts by LC-MS
analysis.
20Molecular biological techniques
Nucleic acids (DNA, RNA) were isolated from frozen mycelia ground to a fine
powder under liquid nitrogen. Genomic DNA was isolated by using the MasterPure Yeast
DNA extraction kit (Epicentre) and total RNA was isolated by using TRIsure (Bioline) with a
subsequent DNase treatment (TURBO DNA-free, Applied Biosystems). cDNA was
transcribed from total RNA using anchored oligo(dT) primers and Superscript III reverse
transcriptase (Invitrogen). Plasmids were isolated by the NucleoSpin Plasmid kit (Machery-
Nagel) and DNA was restricted with FastDigest endonucleases (Fermentas). PCR products for
plasmid constructions were always amplified by proofreading polymerases (Accuzyme from
Bioline or Phusion polymerase from Finnzymes). All PCR products were first cloned into the
pJET1.2 vector (Fermentas) and excised and subcloned as indicated.
Construction of partial ATEG00325 PKS-NRPS deletion mutants
Partial ATEG00325 deletion mutants were generated from strain A1156,
A1156/akuB and SBUG844akuB. The partial deletion construct consisted of a flanking
1175 bp upstream and a 1209 bp downstream fragment separated by the pyrithiamine
resistance cassette (ptrA), which replaced the first 1594 bp of the ATEG00325 coding region
and 22 bp upstream the ATG start codon. The upstream fragment was amplified from
genomic DNA with P11 and P12 and the downstream fragment with P13 and P14. Fragments
were gel purified, mixed, fused by polymerase elongation and amplified by addition of
flanking oligonucleotides P11 and P14. The PCR product was cloned into pJET1.2, excised
with SmaI and subcloned into pUC19. The resulting plasmid was linearized by NotI
restriction separating up- and downstream region and the NotI restricted ptrA cassette from
plasmid ptrA-pJET1 (Fleck and Brock, 2010) was inserted. The resulting deletion cassette
ptrA-00325up+in was excised by SmaI restriction, gel purified and used for transformation.
Transformants were analyzed by Southern blot with a digoxygenin labeled probe amplified
with oligonucleotides P11 and P12 as described in the manufacturer’s protocol (Roche
Diagnostics).
Construction of promoter:lacZ fusion strains
Genomic DNA from E. coli BL21 (DE3) (Novagen) served as template to amplify the
-galactosidase encoding lacZ gene with oligonucleotides P15 and P16. Cloning into pJET1.2
resulted in plasmid lacZ-pJET1.2. A 375 bp tryptophan synthase terminator sequence from A.
terreus (trpCT, locus ATEG00504) was amplified from genomic DNA of SBUG844 with P17
and P18. The NcoI and HindIII digested fragment was cloned into lacZ-pJET1.2 resulting in
plasmid lacZ-trpCT-pJET1.2. Subsequent restriction with BamHI and NotI enabled cloning of
different promoters 5´ of the lacZ gene.
The glyceraldehyde-3-phosphate dehydrogenase promoter (PgpdA, locus
ATEG10199), the arginase promoter (PagaA, locus ATEG04679) and the ATEG00325
promoter (P00325) were amplified with oligonucleotides P19 + P20 (1050 bp), P21 + P22
(1184 bp), and P23 + P24 (1561 bp), respectively. P00325 and PagaA were subcloned by NotI
and BamHI restriction, whereas PgpdA was cloned by NotI and BglII restriction resulting in
plasmids PgpdA-lacZ-trpCT-pJET1.2, PagaA-lacZ-trpCT-pJET1.2 and P00325-lacZ-trpCT-
pJET1.2. All plasmids were linearized by NotI restriction and either the ptrA or the
hygromycine resistance cassette (hph; (Fleck and Brock, 2010)) was inserted. The resulting
plasmids were used to transform strain SBUG844 and transformants were checked for single
ectopic integrations by Southern blot with a digoxygenin labeled probe directed against the
lacZ gene, which was amplified with oligonucleotides P25 and P26.
Construction of transcription factor overexpression strains
The multiple cloning site (MCS) of the pUC19 vector was expanded by ligating the
PCR amplified MCS (P27 and P28) from pJET1.2 into a PstI and HindIII restricted pUC19
vector resulting in plasmid MCS-pJET-pUC19. The putative transcription factor ATEG00326
21including its terminator sequence was amplified with P29 and P30 and subcloned by BamHI
and KpnI restriction into MCS-pJET-pUC19 resulting in 00326+T_(MCS-pJET)-pUC19. The
A. terreus gpdA and agaA promoters were amplified as described above and fused with the
subcloned ATEG00326 gene via BglII/NotI and BamHI/NotI restriction, respectively. Finally,
the ptrA or hph resistance cassette was cloned into the NotI restriction site. Plasmids were
used for transformation of strain SBUG844 and strain SBUG844/P00325:lacZ. A Southern
blot with digoxygenin labeled probes against the ptrA (P33 and P34) and the hph (P35 and
P36) cassette was used to determine the number of integrations.
Determination of arginase activity
For determination of arginase activity a coupled enzymatic assay with urease and L-
glutamate dehydrogenase as helping enzymes was used. Arginase converts L-arginine into L-
ornithine and urea. Urea is converted by urease into CO2 and ammonium. Finally, L-glutamate
dehydrogenase aminates 2-oxoglutarate with ammonium in a NADH-dependent reaction,
which leads to L-glutamate and NAD. Activity was, therefore, determined by the reduction of
NADH at 340 nm with a millimolar extinction coefficient of 6.2 mM-1 cm-1. The assay in a
final volume of 1 mL contained: 50 mM Tris/HCl (pH 9), 0.5 mM ADP, 0.3 mM NADH, 2
mM 2-oxoglutarate, 4.8 U L-glutamate dehydrogenase from bovine liver (type II), 12 U
urease from Canavalia ensiformis (both enzymes from Sigma Aldrich), 1 mM MnSO4, and 2 -
10 µL cell-free extract. The reaction was started by addition of 10 mM L-arginine.
Calculation of 13C contents in leucine labeled isoflavipucine
13
C contents were calculated based on the natural 13C-content of unlabeled carbons.
The signals of carbons in the NMR spectrum of the control experiment were integrated using
the Lorentz distribution (Bruker Topspin 2.1 software). The calculated area was relatively
referred to the area of an unlabelled carbon (C-9) in the 13C-spectrum of unlabeled
isoflavipucine (1). The response factor RF was used for calculation of the 13C-incorporation
of the signal for C-7 in labeled 1.
AulR
RF
Aulx
AlR Alx RF
1.1% X
AulR: area of the reference carbon in the 13C-spectrum of unlabeled 1
AlR: area of the reference carbon in the 13C-spectrum of labeled 1
AulX: area of the desired carbon in the 13C-spectrum of unlabeled 1
AlX: area of the desired carbon in the 13C-spectrum of labeled 1
1.1%: relative natural occurrence of 13C
X: % 13C of the desired carbon
SUPPLEMENTAL REFERENCES
Fleck, C.B., and Brock, M. (2010). Aspergillus fumigatus catalytic glucokinase and
hexokinase: expression analysis and importance for germination, growth, and conidiation.
Eukaryot. Cell 9, 1120-1135.
Henry, T., Iwen, P.C., and Hinrichs, S.H. (2000). Identification of Aspergillus species using
internal transcribed spacer regions 1 and 2. J Clin. Microbiol. 38, 1510-1515.
22You can also read
