A point mutation in the proteoiipid protein gene of the 'shaking pup' interrupts oiigodendrocyte development
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Development 110, 529-537 (1990) 529
Printed in Great Britain © The Company of Biologists Limited 1990
A point mutation in the proteoiipid protein gene of the 'shaking pup'
interrupts oiigodendrocyte development
NANCY L. NADON 1 *, IAN D. DUNCAN2 and LYNN D. HUDSON1
1
Laboratory of Viral and Molecular Pathogenesis, NINDS, NIH, Bethesda MD USA
2
School of Veterinary Medicine, University of Wisconsin, Madison WI, USA
•Address for correspondence: Faculty of Biological Sciences, University of Tulsa, 600 S. College Ave, Tulsa, OK 74104, USA
Summary
The differentiation of the oiigodendrocyte from its PLP locus characteristic of immature oligodendrocytes.
bipotential progenitor culminates in the production of The spliced transcript expressed earliest in development,
the myelin-specific proteins and the elaboration of DM-20, continues to be overexpressed in shaking pup
membrane processes that ensheath the axon. Mutations oligodendrocytes. The disruption of the normal matu-
in proteoiipid protein (PLP) and its alternatively spliced ration schedule in these X-linked dysmyelinating dis-
isoform DM-20, the major protein constituents of orders suggests that PLP or DM-20 plays a fundamental
central nervous system myelin, are characterized by a role in oiigodendrocyte development. We propose that,
significant reduction in the number of mature oligoden- while the more abundant PLP is the primary structural
drocytes, resulting in severe hypomyelination, tremor component of myelin, DM-20 may be critical to
and early death. The canine shaking pup carries such a oiigodendrocyte maturation.
mutation, a single base change that substitutes a proline
for a histidine near the first transmembrane region of Key words: dysmyelination, mutant, myelin, glia, jimpy,
PLP and DM-20. This mutation hinders oiigodendrocyte proteoiipid protein gene, oiigodendrocyte, canine
differentiation, as evidenced by a splicing pattern at the development.
Introduction identical to PLP with the exception that it lacks 35
amino acids in the middle of the protein (Nave et al.
Myelination is a developmentally controlled process 1987a). DM-20 is present before PLP in the developing
whereby neuronal axons are enwrapped by a multilayer CNS, but is gradually superceded by PLP, which
membrane sheath. In the central nervous system predominates in mature and actively myelinating
(CNS), this function is carried out by the oiigodendro- oligodendrocytes (Kronquist et al. 1987; Van Dorssa-
cyte, a terminally differentiated glial cell that sends out laer et al. 1988; Gardinier and Macklin, 1988). The
membrane processes to ensheath numerous axons. The evidence that PLP and/or DM-20 may play a role in the
assembly of the myelin sheath caps the development of maturation of the oiigodendrocyte comes primarily
the oiigodendrocyte from a bipotential progenitor cell from the study of animals carrying mutations in the PLP
that will differentiate into either an oiigodendrocyte or gene. To date, mutations in the X-linked PLP gene
a type II astrocyte depending on the signals it receives have been identified in the mouse and rat, as well as in
(reviewed by Raff et al. 1989; Dubois-Dalcq and three distinct lineages of the human Pelizaeus-Merz-
Armstrong, 1990). In addition to the several growth bacher disease. The jimpy mouse carries a point
factors that have been shown to play a role in this mutation in a splice junction that results in the deletion
developmental pathway, it has been suggested that of exon 5 from the PLP/DM-20 mRNA, with a
proteoiipid protein (PLP), the predominant structural resulting frameshift and premature termination (Nave
protein in the myelin sheath, may be important in the et al. 19876; Macklin et al. 1987a). In contrast, the
maturation of the oiigodendrocyte (Hudson et al. 1987). mutations identified in the myelin synthesis deficient
PLP is an extemely hydrophobic transmembrane (jimpy™"1) mouse, the myelin deficient (md) rat and the
protein that is highly conserved between species. three Pelizaeus-Merzbacher lineages have all been
Alternative splicing within exon 3 of the PLP gene point mutations resulting in different single amino acid
generates a less abundant isoform, DM-20, that is substitutions present in both PLP and DM-20 (Gencic530 N. L. Nadon, I. D. Duncan and L. D. Hudson
and Hudson, 1990; Boison and Stoffel, 1989; Gencic et postulate that the developmental delay in shaking pup
al. 1989; Hudson et al. 1989a; Trofatter et al. 1989; oligodendrocytes originates from the loss of functional
Simons and Riordan, 1990). Despite the variation in the DM-20 protein.
mutations detected, the phenotypes of the different
mutants are strikingly similar. These mutations result in
severe dysmyelination of the CNS, tremor and early Materials and methods
death. There is a reduction in the number of mature
oligodendrocytes and consequently the levels of all Northern and Southern blot hybridization
myelin proteins are greatly reduced (Matthieu et al. Total RNA was isolated from brains and spinal cords by the
1973; Meier and Bischoff, 1975; Skoff, 1976; Billings- guanidinium isothiocyanate method as described by Maniatis
Gagliardi et al. 1980a; Wolf et al. 1983; Kerner and et al. (1982). RNA was run on 1.0% agarose gels, blotted
Carson, 1984; Jackson and Duncan, 1988). This paucity onto nitrocellulose and hybridized to 32P-labelled probes as
of mature oligodendrocytes is not observed in animals described by Nadon et al. (1988). Quantitation of RNA levels
was accomplished by directly counting the radioactivity on the
carrying mutations in other myelin proteins, which Northern blots using an Ambis Radioanalytic Imaging System
suggests that it is not simply due to the lack of (Ambis Systems Inc., San Diego CA). Southern blots were
myelination (reviewed by Campagnoni and Macklin, prepared as described by Southern (1975) and hybridized
1988). overnight at 42° in a buffer containing 50% formamide
In this report, we describe a mutation in the PLP (omitted for oligonucleotide probes), 5xSSPE, 5x
gene of the dog and provide molecular evidence for a Denhardts, 1% SDS and 100 ^ m l " 1 denatured salmon
role of PLP and/or DM20 in oligodendrocyte matu- sperm DNA. Northern and Southern blots were washed post-
hybridization in lxSSC-1% SDS at room temperature for
ration. The shaking pup arose spontaneously in a line of 20-30min and in 0.1% SSC-1% SDS at 55-65° for
springer spaniels and is characterized by a severe 10-30 min. The human PLP cDNA (Puckett et al. 1987),
tremor beginning at about twelve days of age followed mouse MBP cDNA (de Ferra et al. 1985) and mouse GFAP
by late onset convulsions and, under natural conditions, cDNA (Lewis et al. 1984) were radiolabelled using the BRL
an early death by about 3-4 months of age (Griffiths et Nick Translation kit (BRL, Gaithersburg MD) according to
al. 1981a). The peripheral nervous system is normal, the manufacturers specifications. Oligonucleotides were
but the CNS exhibits severe hypomyelination and a synthesized on an Applied Biosystems DNA Synthesizer and
reduction in the number of mature oligodendrocytes were end-labelled with [32P]y-ATP (Amersham, Arlington
(Duncan et al. 1983). The residual myelin present in the Heights IL) in a reaction containing 0.2 mg oligonucleotide,
CNS is poorly compacted and displays several features 100jiCi y-ATP, 10mM DTT, 50 mM glycine pH9.5, 10 mM
MgCl2, and 5-10 units T4 polynucleotide kinase (New
that appear in myelin from younger control animals, England Biolabs, Beverly MA). After a 30min incubation at
such as increased amounts of cytoplasm in the lateral 37°, the labelled oligonucleotides were purified by passage
loops, lateral loops that terminate outward and over a Sep-pak C18 cartridge (Waters Associates, Milford
internodal or paranodal pockets of oligodendrocyte MA).
cytoplasm (Griffiths et al. 1981b). Previous work has
demonstrated that all of the CNS myelin proteins
assayed in the shaking pup are reduced in amounts, Library preparation and DNA sequencing
Genomic DNA from shaking pup and normal dog was
with PLP the most drastically affected, down to 0.8 % partially digested with Sau3A restriction enzyme (New
of the normal dog (Inuzuka et al. 1986; Yanagisawa et England Biolabs) and ligated into the EMBL 3 vector
al. 1987). This result, in combination with the X-linked (Stratagene, La Jolla CA) according to the manufacturers
inheritance of the defect and the parallels between the protocol. The ligated DNA was packaged using the Gigapack
shaking pup disorder and the jimpy mouse, suggested Plus system (Stratagene). Phage clones were mapped by
the PLP gene as the target for the mutation in the hybridization of Southern blots to exon-specific oligonucleo-
shaking pup. Indeed, our analysis of the PLP genes tide probes and by lambda-Cos mapping as described by
from normal dog and shaking pup has revealed a point Rackwitz et al. (1984). EcoRI fragments containing PLP
mutation in the PLP gene that creates a histidine to exons were subcloned into pT7T3 plasmid vectors obtained
proline change in both the PLP and DM-20 amino acid from Pharmacia (Piscataway NJ).
sequence. The identification of a canine dysmyelinating The PLP protein-encoding and flanking sequences were
model for the human Pelizaeus-Merzbacher disease sequenced from both the shaking pup and a normal male
enables the further analysis of disease parameters not littermate. Sequencing of the shaking pup gene was per-
readily assayable in rodents (e.g. nerve conduction formed on plasmid subclones of the phage genomic clones,
using the GemSeq K/RT system (Promega, Madison Wl)
velocities) and more importantly, presents a better according to the manufacturer's instructions. Sequencing of
paradigm for the evaluation of therapeutic strategies for the normal dog locus was accomplished by amplification of the
this debilitating disease. In addition, evidence is exons directly from genomic DNA using the polymerase chain
presented that indicates that the oligodendrocytes of reaction (PCR) (Saiki et al. 1988) and sequencing the
the shaking pup are delayed in their maturation, as the amplified DNA. The sequence of exon 2 from the shaking pup
developmentally regulated pattern of alternative was also verified by sequencing PCR amplified genomic
splicing in this mutant is altered and reflects those DNA. PCR was performed with Taq DNA polymerase from
observed in immature oligodendrocytes. In light of the Stratagene, using conditions recommended by the manufac-
initial preeminence of DM-20 over PLP in the early turer. The amplification consisted of 30 cycles of a lmin
stages of normal oligodendrocyte differentiation, we denaturation at 95°, a 2 min annealing step at 55°, and a 3 min
elongation step at 70° with a 7 min extension of the elongationThe shaking pup is a point mutation in PLP 531
step after the 30th cycle. PCR amplified DNA was purified by
four washes through a Centricon 30 filter (Amicon, Danvers
MA) before using it for sequencing. Sequencing of the PCR 2 3 4 5 6
amplified DNA was performed according to Higuchi et al. • l T I I • I*
(1988) using ^P-labelled primers and the Sequenase DNA BUD n RB R B RB B R
polymerase (U. S. Biochemical, Cleveland OH), which is ShP 11
described by Tabor and Richardson (1987). Sequencing
reactions were run on 6% acrylamide/8 M urea sequencing
gels in Tris-borate buffer, which were fixed for 30 min in 10 %
methanol/10% acetic acid and dried before autoradiography.
All DNA was sequenced from both strands.
The 17-mer primers used for sequencing the canine PLP Fig. 1. Map of the canine PLP genomic locus. The
gene corresponded to intronic sequences (except for the 5' structure of the canine PLP genomic locus was determined
flanking region, first and last exons) as follows: by mapping the exons within three overlapping genomic
5' flanking (antisense) 5' TTTGTTCAGCTGGAAGG 3', DNA clones from the shaking pup. The phage DNA was
5'GCCTGCTTGAATCTTCC 3' digested with BamHl (B), EcoRI (R) or both enzymes
Exon 1 (sense) 5' TGTCAATCAGAAAGCCC 3' simultaneously, run on a 0.7% gel and Southern blotted.
Exon 1 (antisense) 5' ACCATTGGAAACCCCAA 3' The blots were hybridized to 32P-labelled exon-specific
Exon 2 (sense) 5' CCACAGAGAGGTATGAG 3' oligonucleotide probes. Verification of the exon positions
Exon 2 (antisense) 5' TCTATATGTCTTCAGGG 3' was obtained through the sequence analysis, which
Exon 3 (sense) 5' GAAGGGAACTGTCCTCA 3' localized restriction sites within the exons or in the
Exon 3 (antisense) 5' CAGACTCACGCCCAATT 3' immediately flanking intron sequences. The gene spans
Exon 4 (sense) 5' TCAATGTCTACAGGCCA 3' approximately 18 kb. The exons are numbered above the
Exon 4 (antisense) 5' AGTGCTTTCATAGGAGG 3' line and filled areas denote protein-encoding sequences.
Exon 5 (sense) 5' AATCTCCATGGAGCCCA 3'
Exon 5 (antisense) 5' AAAGGCCATGGGTAGGA 3'
Exon 6 (sense) 5' GCTGCATGCATGATCTA 3' bands displayed by the shaking pup DNA was
Exon 6 (antisense) 5' TTCCCAGGTGCTTCTCT 3' indistinguishable from that of the normal dog, indi-
Exon 7 (sense) 5' TCCCAAAAGCTTTGGAG 3' cating that there are no gross deletions or rearrange-
Exon 7 (antisense) 5' CGTCAAGTAAGAAGAGG 3' ments in the PLP gene. In order to analyze the genomic
structure of the canine PLP locus in more detail, a
RNAse protection assay library was made from shaking pup genomic DNA.
Antisense RNA probes were made using the Gemini II Phages containing inserts from the PLP locus were
Riboprobe kit (Promega, Madison WI), utilizing 200 ng of isolated by plaque hybridization using the human PLP
PCR-generated template DNA that included the T7 polym- cDNA, and overlapping clones were obtained. These
erase site at the 3' end. This template was made from genomic clones were mapped by restriction enzyme digestion
DNA using a 24 base sense primer that started 14 bases 5' to and hybridization to exon-specific probes. The map of
exon 3 (5' ATCTGTTAATGCAGGATCCATGCC 3') and a the canine PLP locus is presented in Fig. 1. The gene
46 base antisense primer that included 26 bases from intron 3 contains seven exons, spanning a distance of 18 kb. The
(46-71 bases 3' of exon 3) and 20 bases that encode the T7 genomic organization of the canine PLP gene is very
polymerase binding site (5' TGTAATACGACTCACTATA similar to that of the mouse (Macklin et al. 1987b;
GATGAGGCCACAGACTCACGCCCAATT 3'). The total
size of the probe produced from this DNA is 347 bases. Gencic and Hudson, 1990) and human (Diehl et al.
RNAse protection assays were performed essentially as 1986; Hudson etal. 1989a) PLP genes. The intron/exon
describe by Winter et al. (1985), with the following boundaries are identical and only minor differences in
modifications. Hybridizations containing H^ctsmin" 1 of intron size are observed between species.
probe and 30 ng total brain RNA were heated to 65° for 5' and
then incubated at 46° for 16-18 h. Digestion with The shaking pup PLP locus contains a point mutation
500 units mP 1 RNAse T! (BRL, Gaithersburg MD) was in exon 2
carried out at 16° for one hour. Samples were run on 6%
sequencing gels and the amounts of radioactivity in the PLP The sequence of the normal canine PLP locus is
and DM-20 bands were directly quantitated on an Ambis presented in Fig. 2. Of the 276 amino acids in the PLP
Radioanalytic System. The ratio of DM-20 to PLP RNA was protein, there is only one amino acid difference
calculated from the average of three different RNAase between the canine and mouse, rat and human
protection gels, after correcting the counts in the DM-20 band proteins, an isoleucine at nucleotide position 591 of the
for the difference in size of the protected fragments. canine locus instead of the valine in the other species.
At the nucleotide level, there is 97% conservation
between canine protein-encoding sequences and those
Results of the rat, mouse and human (reviewed by Hudson and
Nadon, 1990).
The PLP gene from the shaking pup does not contain Fig. 3 presents the sequence of exon 2 from the
any gross deletions or rearrangements shaking pup. There is a point mutation at position 219
Genomic DNA from a shaking pup and a normal male of the coding sequence that results in a histidine to
littermate were digested with restriction enzymes and proline change in the protein. This is the only sequence
analyzed by Southern blot hybridization using a human difference between the normal dog and the shaking
PLP cDNA probe (data not shown). The pattern of pup. All protein-encoding sequences, splice junctions,532 N. L. Nadon, I. D. Duncan and L. D. Hudson
130 . 150
-170 -150 -130 ccagGCTTGTTAGAGTGCTGTGCAAGATGTCTTGTAGGGGCCCCCTTTGCTTCCTT
....aagaagatggagcccttagagaagggagtatccctaaggaggtggggacaag G L L E C C A R C L V G A P F A S L
-110 . -90 . -70 170 . 190 . 210
gggaggagaaggggaggaggagaggaggaggaaagcaggcctgtctctttaagggg GGTGGCCACTGGATTATGTTTCTTTGGGCTGGCACTGTTCTGTGGCTGTGGACCTG
-50 . -30 V A T G L C F F G V A L F C G C G P
gttggctgtcaatcagaaagcccttttcattgcaggagaagaggacaaagatactc 230 . 250 . 270
-10 1 10 . 3 0 AAGCATTAACTGGTACAGAAAAGCTAATTGAGACCTATTTCTCCAAAAACTACCAG
agagagaaaaagtAGAGGACCGAAGAAGGAGACTGGAGAGACCAGGATCCTTCCAG E A L T G T E K L I E T Y F S K N Y Q
50 . 7 0 . 90 290
CTGAACAAAGTCAGCAGCAAAGCAGACTAGCCAGCTGGCTAC^TTGGAGTCAGAG GACTATGAGTATCTCATCAATGTgtaa
110
TTCCAAAGACATGGgtgagtttcaaagac....intron.l....cttcttcttcc
M
130 . 150 G ATC GAT C
CCagGCTTGTTAGAGTGCTGTGCAAGATGTCirGTAGGGGCCCCCTTTGCTTCCTT
G L L E C C A R C L V G A P F A S L
i
170 . 190 . 210
GGI^KCACTGGATTATGTTTCTTTGGGGTGGCACTGTTCTGTGGCTGTGGACATG
V A T G L C F F G V A L F C G C G H
230 . 250 . 270
AAGCATTAACTGGTACAGAAAAGCTAATTGAGACCTATTTCTCCAAAAACTACCAG
E A L T G T E K L I E T Y F S K N Y Q
290
GACTATGAGTATCTCATCAATGTgtaagtacctgttat.... intron. 2. . . . ta
D Y E Y L I N V
310 . 330
tCtgttaatgcagGATCCATGCCTTCCAGTATGTCATCTATGGAACTGCCTCTTTC
I H A F Q Y V I Y G T A S F
350 . 370 . 390
TTCTTCCTTTATGGGGCCCTCCTGCTGGCTGAGGGCTTCTACACCACCGGTGCAGT
F F L Y G A L L L A E G F Y T T G A V
410 . 430 . 450
CAGGCAGATCTTI«a^»CTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCAA CON SHP
R Q I F G D Y K T T I C G K G L S A
470 . 490 . 510
CGThe shaking pup is a point mutation in PLP 533
SH P CON
brain cord
2WK 10WK 2WK 10WK
M uncut Ava uncut Ava II C S C S Mu C S C S
cord
! brain
II
cord brain
S C S C S C S C
B
Fig. 4. The point mutation in the shaking pup creates a
new Avail restriction site. Exon 2 was amplified from
genomic DNA of the shaking pup (SH P) and a normal
male littermate (CON) by PCR using primers in the intron MBP GFAP
sequences immediately flanking the exon. The DNA was
digested with Avail (recognition site: GGACC), and both Fig. 5. Northern blot analysis of shaking pup and normal
digested and undigested DNA was run on a 3 % Nusieve dog RNA. (A) Northern blots containing 10/ig/lane total
agarose/1% Seakem ME agarose gel, using HaeHl RNA were hybridized with nick translated human PLP
digested 0X174 DNA as a marker (M). Avail cleaves exon cDNA probe. RNA was from brains and spinal cords of
2 DNA from the shaking pup, but not from the control two and ten week old shaking pups (S) and normal male
normal dog. The faint bands result from nonspecific littermates (C), and from mouse brain (Mu). (B) Northern
priming during the PCR. The PCR reactions used for the blots containing 10 fig/lane total RNA were hybridized to
^vall digests were prepared separately from the reactions •^P labelled probes made from the mouse MBP cDNA or
used for sequencing. mouse GFAP cDNA. RNA was from brains and spinal
cords of a ten week old shaking pup (S) and a normal male
littermate (C).
message levels was also quantitated with slot blots,
yielding the same results (data not shown). The mRNA
for GFAP, an astrocyte-specific protein, is increased by ratio of DM-20 to PLP also falls as the animal ages, but
30% over control levels, possibly indicating astrocytic it is still much higher than in controls. In fact, the ratio
hypertrophy in the shaking pup (Fig. 5B). Such of DM-20 mRNA to PLP mRNA in the four week
hypertropy is also observed in the jimpy mouse (Skoff, shaking pup (0.59) is very similar to the ratio observed
1976). in the one day control (0.50), and in the one day shaking
pup the ratio of DM-20 to PLP mRNA is much higher
DM-20 transcripts are preferentially expressed in the (2.33), with DM-20 mRNA predominating over PLP.
shaking pup To summarize, the RNA analysis illustrates two
The Northern blots presented in Fig. 5 do not facets of the development of the oligodendrocytes in
differentiate between PLP and DM-20 mRNAs, as they the shaking pup. One is that the amount of RNA from
differ by only 105 bases. PLP mRNA is derived from the PLP gene, and the MBP gene as well, is reduced at
exons 1-7 (in their entirety) of the PLP gene, while all ages, reflecting the paucity of oligodendrocytes
DM-20 mRNA arises when a donor splice site located (Fig. 5). The other is that although the ratio of DM-20
within exon 3 is used in conjunction with the acceptor to PLP message decreases with age in the mutant as it
splice site of exon 4 (Nave et al. 1987a). To quantitate does in the control, the ratio is consistently much higher
the levels of the two specific messages, RNAse in shaking pup oligodendrocytes than in age-matched
protection assays were performed using an RNA probe controls (Fig. 6), indicating that the mutant oligoden-
that encompasses the alternatively spliced exon, exon 3. drocytes lag behind their control counterparts in their
Fig. 6 shows the results of one such assay in which the development.
exon 3 RNA probe was hybridized to total brain RNA
from four week old and one day old shaking pups and
age-matched controls. The upper band is the protected Discussion
fragment resulting from hybridization of the probe to
the PLP mRNA, and the lower band is the protected PLP is believed to play an essential role in the
fragment from the DM-20 message. In normal dogs, the compaction of the myelin sheath, possibly through
DM-20 to PLP ratio is 0.50 at one day of age, and homophilic interactions between domains of the protein
decreases to 0.32 by four weeks. In the shaking pup, the localized on the external surface of the myelin534 N. L. Nadon, I. D. Duncan and L. D. Hudson
membrane (Hudson et al. 19896). This protein exhibits
a very high degree of conservation between species,
with rat, mouse and human proteins sharing 100%
amino acid identity (reviewed by Hudson and Nadon,
1990), and the dog diverging by only one amino acid
4 wk 1 d (Fig. 3). Previous studies on other animal mutants and
o the human Pelizaeus-Merzbacher disease have demon-
5. C S C S strated that even relatively conservative amino acid
changes in the protein destroy its ability to function
• 2 • (reviewed by Hudson and Nadon, 1989). We have
documented a point mutation in the dog, which
produces a histidine to proline substitution, that results
in such a loss of function. This was the only sequence
difference found between the shaking pup and normal
dog. It is extremely unlikely that the exon 2 mutation is
# - a secondary mutation arising due to the loss of selective
pressure for the proper sequence. The shaking pup was
discovered quite recently (first reported by Griffiths et
al. 1981a) and there have only been three generations
between its discovery and the animals used in this
molecular analysis. Therefore, this single amino acid
substitution appears to have a great affect on the
function of the protein.
It is perhaps significant that the mutation in the
shaking pup results in the substitution of a proline for a
histidine on the intracellular edge of the first transmem-
brane region of the protein. Prolines have been shown
to have the capability of changing the direction of the
amino acid chain, and in fact are generally excluded
from intramembrane regions of proteins (Brandl and
Deber, 1986). The histidine to proline substitution may
result in the disruption of the alpha-helical structure of
the protein chain and thus prevent the correct folding
and/or insertion of the protein into the membrane. An
observation that is consistent with this explanation is
that oligodendrocytes in the shaking pup are character-
ized by prolific distended rough endoplasmic reticulum
(Duncan etal. 1987). PLP is normally synthesized in the
RER and transported to the membrane through the
Golgi apparatus (Colman et al. 1982; Roussel et al.
1987). The mutant PLP/DM-20 protein of the shaking
pup must also traverse this pathway, since PLP/DM-20
is immunocytochemically detectable in myelin sheaths
(Yanagisawa et al. 1987). However, the mutant protein
may assume an abnormal configuration that retards its
trafficking from the RER to the Golgi and consequently
impairs the transport of other proteins, resulting in the
distention of the RER.
The diminished level of PLP transcripts in shaking
Fig. 6. The ratio of the DM-20 and PLP mRNAs is altered pup (Fig. 5A) probably reflects the reduced number of
in the shaking pup. RNAse protection assay was performed mature oligodendrocytes in this mutant (Duncan et al.
on total brain RNA from four week old and one day old 1983), as a similar reduction exists for MBP transcripts
control (C) and shaking (S) pups. The 347 base probe was (Fig. 5B). Moreover, by combining in situ hybridization
from the genomic sequence of the canine PLP locus, histochemistry with quantitative image analysis, Verity
encompassing the entire third exon, 14 bases of intron 2 et al. (1990) determined that the reduced PLP and MBP
and 71 base of intron 3. The larger protected fragment of mRNA expression in jimpy mice was due primarily to
262 bases corresponds to the PLP mRNA and the smaller
one (157 bases) to the DM-20 mRNA. Radioactivity was fewer cells expressing these transcripts. It is worth
quantitated on an Ambis Radioanalytic System. The noting that both PLP and MBP protein levels of shaking
marker (M) is end-labelled Mspl digest of pBR322. pup exhibit a much greater reduction (to 0.8% and
3-6% of controls, respectively (Yanagisawa et al.
1987)) than their message levels (20% and 25% ofThe shaking pup is a point mutation in PLP 535
controls; Fig. 5). While it is anticipated that a mutant pattern of oligodendrocyte differentiation observed in
protein (PLP) would be readily degraded, the obser- other species, in that the DM-20 to PLP ratio declines
vation that MBP is also severely depressed suggests that with age (Fig. 6; Results). Examination of the MBP
oligodendrocytes have translational or post-trans- isoforms that are also developmentally regulated in
lational mechanisms for preventing the accumulation of oligodendrocytes (Inuzuka et al. 1986) provides further
myelin proteins whenever myelin assembly is blocked. support for the concept that oligodendrocyte develop-
A discrepancy between the levels of myelin messages ment is retarded in the PLP mutants. The ratios of the
and myelin proteins has also been observed in other MBP isoforms in both the jimpy mouse and the shaking
PLP mutants (reviewed in Hudson and Nadon, 1990), pup are shifted to mirror an earlier stage of develop-
again indicating that oligodendrocytes prevented from ment (Campagnoni et al. 1984; Inuzuka et al. 1986).
fully differentiating and assembling a myelin sheath In summary, mutations in PLP and DM-20 prevent
either limit the translation of myelin proteins or greatly the normal schedule of maturation of oligodendrocytes
enhance the degradation of these surplus proteins. and therefore one or both of these proteins must play a
One of the most perplexing aspects of the PLP role in the development of these cells. We propose that
mutants is how a point mutation in a structural protein DM-20 is involved in oligodendrocyte maturation, since
such as PLP could have such a dramatic effect on the it precedes PLP in development. Experimental support
fate of the oligodendrocytes. Not only is there a for the suggestion that DM-20 may be an important
depletion of mature oligodendrocytes in the shaking component of the oligodendrocyte developmental
pup (Duncan et al. 1983), but the surviving oligoden- pathway comes from attempts to express each isoform
drocytes appear immature by both morphological individually in vivo. Transgenic mice were made that
(Griffiths et al. 1981ft) and molecular (Fig. 6) criteria. It carry a construct encoding the human PLP protein, but
is unlikely that the lack of mature oligodendrocytes in not DM-20 (Nadon et al. 1989). One line of mice that
each of these disorders is due to toxicity of the mutant produces high levels of transgene-specific RNA was
PLP/DM-20, since jimpy oligodendrocytes can flourish crossed to the jimpy line, and male offspring carrying
and synthesize myelin, albeit abnormal myelin, when both the mutation and the transgene were analyzed by
the cells are cultured in medium conditioned by normal immunocytochemistry and electron microscopy. There
astrocytes or transplanted into a non-jimpy host was no evidence of expression of the transgene PLP
(Gumpel et al. 1987; Bartlett et al. 1988). These protein in these mice and they exhibited the same
experiments suggest that despite the continued pro- degree of hypomyelination as jimpy mice. Although
duction of mutant PLP/DM-20 protein, jimpy oligo- there are several possible explanations for this result, it
dendrocytes can survive and attempt myelination when is consistent with a regulatory role for DM-20. If DM-20
presented with the proper factors. is essential for the development of the oligodendro-
Analysis of developmentally regulated protein iso- cytes, the cells in the jimpy/transgenic mice would still
forms has provided molecular evidence that the be inhibited in their development since the transgene
oligodendrocytes present in the shaking pup and the does not make DM-20. Analysis of transgenic mice
other PLP mutants are prevented from fully maturing. expressing only the DM-20 isoform should provide
DM-20 is expressed before PLP in the human, rat, cow direct evidence for the function of this alternatively
and mouse, and the ratio of DM-20 to PLP decreases as spliced product of the PLP locus.
PLP expression rises (Kronquist et al. 1987; Van
Dorssalaer et al. 1988; Gardinier and Macklin, 1988). In The authors thank Dr N. Cowan for providing the GFAP
both jimpymsd and the shaking pup, approximately cDNA, Pete Kelly for supplying synthetic oligonucleotides
equal amounts of PLP and DM-20 protein are present and Drs Heinz Arnheiter and Bryn Watkins for critical review
during the period of active myelination, while in normal of the manuscript. This work was supported in part by grants
animals the ratio of DM-20 to PLP is 0.25 and 0.06 to I. D. D. from the National Institutes of Health (NS23124)
and from the National Multiple Sclerosis Society (RG1791).
respectively (Yanagisawa et al. 1987; Gardinier and
Macklin, 1988). The mutant DM-20 protein may be in
excess in these two disorders because it is more stable References
than the mutant PLP. However, analysis of the
transcripts encoding DM-20 and PLP in the shaking pup BARTLETT, W. P., KNAPP, P. E. AND SKOFF, R. P. (1988). Glial
suggests that regulation occurs at the transcriptional conditioned medium enables jimpy oligodendrocytes to express
level as well, and that the alternative splicing of the PLP properties of normal oligodendrocytes: production of myelin
antigens and membranes. Giia 1, 253-259.
locus in shaking pup oligodendrocytes is locked into the BILUNGS-GAGUARDI, S., ADCOCK, L. H., SCHWING, G. B. AND
early developmental pattern observed in immature WOLF, M. K. (1980a). Hypomyelinated mutant mice.
oligodendrocytes (Fig. 6). The DM-20 to PLP mRNA II. Myelination in vitro. Brain Res. 200, 135-150.
ratio in the four week old shaking pup is very close to BOISON, D. AND STOFFEL, W. (1989). Myelin-deficient rat: a point
the ratio observed for the one day control dog, and in mutation in exon III (A—>C, Thr75—»Pro) of the myelin
proteolipid protein causes dysmyelination and oligodendrocyte
the one day shaking pup, the DM-20 mRNA is even death. EMBO J. 8, 3295-3302.
higher, accounting for 70% of the RNA from the PLP BRANDL, C. J. AND DEBER, C. M. (1986). Hypothesis about the
gene. Although our present work does not contain time function of membrane-buried proline residues in transport
points early enough in development to see expression of proteins. Proc. natn. Acad. Sci. U.S.A. 83, 917-921.
CAMPAGNONI, A. T., CAMPAGNONI, C. W., BOURRE, J. M., JACQUE,
DM-20 alone, the dog does appear to follow the same
C. AND BAUMANN, N. (1984). Cell-free synthesis of myelin basic536 N. L. Nadon, I. D. Duncan and L. D. Hudson
proteins in normal and dysmyelinating mutant mice. /. JACKSON, K. F. AND DUNCAN, I. D. (1988). Cell kinetics and cell
Neurochem. 42, 733-739. death in the optic nerve of the myelin deficient rat. /.
CAMPAGNONI, A. T. AND MACKUN, W. B. (1988). Cellular and Neurocytology 17, 657-670.
molecular aspects of myelin protein gene expression. Mol. KERNER, A.-L. AND CARSON, J. H. (1984). Effect of the jimpy
Neurobiol. 2, 41-89. mutation on expression of myelin proteins in heterozygous and
COLMAN, D. R., KREIBICH, G., FREY, A. B. AND SABATINI, D. D. hemizygous mouse brain. J. Neurochem. 43, 1706-1715.
(1982). Synthesis and incorporation of myelin polypeptides into KRONQUIST, K. E., CRANDALL, B. E., MACKUN, W. B. AND
CNS myelin. /. Cell Biol. 95, 598-608. CAMPAGNONI, A. T. (1987). Expression of myelin proteins in the
DE FERRA, F., ENGH, H., HUDSON, L., KAMHOLZ, J., PUCKETT, C , developing human spinal cord: cloning and sequencing of the
MOUNEAUX, S. AND LAZZARINI, R. A. (1985). Alternative human proteolipid protein cDNA. J. Neurosci. Res. 18,
splicing accounts for the four forms of myelin basic protein. Cell 395-401.
43, 721-727. LEWIS, S. A., BALCAREK, J. M., KREK, V., SHELANSKJ, M. AND
DlEHL, H . - J . , SCHAICH, M . , BUDZ1NSKI, R . - M . AND STOFFEL, W . COWAN, N. J. (1984). Sequence of a cDNA clone encoding
(1986). Individual exons encode the integral membrane domains mouse glial fibrillary acidic protein: structural conservation of
of human myelin proteolipid protein. Proc. natn. Acad. Sci. intermediate filaments. Proc. natn. Acad. Sci. U.S.A. 81,
U.SA. 83,9807-9811. 2743-2746.
DUBOIS-DALCQ, M. AND ARMSTRONG, R. (1990). Oligodendrocyte- MACKUN, W. B., CAMPAGNONI, C. W., DEININGER, P. L. AND
type 2 astrocyte lineage during myelination and remyelination. GARDINIER, M. V. (1987ft). Structure and expression of the
In Myelin: A Treatise, (ed. R. E. Martenson) Telford Press, mouse myelin proteolipid protein gene. J. Neurosci. Res. 18,
Caldwell NJ. 383-394.
DUNCAN, I. D., GRIFFITHS, I. R. AND MUNZ, M. (1983). 'Shaking MACKUN, W. B., GARDINIER, M. V., KING, K. D. AND KAMPF, K.
pups': a disorder of central myelination in the spaniel dog. (1987a). An AG—>GG transition at a splice site in the myelin
III. Quantitative aspects of glia and myelin in the spinal cord proteolipid gene in jimpy mice results in the removal of an
and optic nerve. Neuropath, and Applied Neurobiol. 9, 355-368. exon. FEBS Lett. 223, 417-421.
DUNCAN, I. D., HAMMANG, J. P. AND JACKSON, K. F. (1987). MANIATIS, T., FRITSCH, E. F. AND SAMBROOK, J. (1982). In
Myelin mosaicism in female heterozygotes of the canine shaking Molecular Cloning: A Laboratory Manual. Cold Spring Harbor
pup and myelin-deficient rat mutants. Brain Res. 402, 168-172. Laboratory, Cold Spring Harbor NY pp. 196.
GARDINIER, M. V. AND MACKLIN, W. B. (1988). Myelin proteolipid MATTHIEU, J.-M., WIDMER, S. AND HERSCHKOWITZ, N. (1973).
protein gene expression in jimpy and jimpy"^ mice. J. Jimpy, an anomaly of myelin maturation. Biochemical study of
Neurochem. 51, 360-369. myelination phases. Brain Res. 55, 403-412.
GENCIC, S., ABUELO, D., AMBLER, M. AND HUDSON, L. D. (1989). MEIER, C. AND BISCHOFF, A. (1974). Dysmyelination in jimpy
Pelizaeus-Merzbacher disease: an X-linked neurological disorder mouse. Electron microscopic study. J. Neuropath, exp. Neurol.
of myelin metabolism with a novel mutation in the gene 23, 343-353.
encoding proteolipid protein. Am. J. hum. Genet. 45, 435-442. NADON, N., ARNHEITER, H., CHANG, S. AND HUDSON, L. (1989).
GENCIC, S. AND HUDSON, L. D. (1990). Conservative amino acid Expression of the human proteolipid protein gene in transgenic
substitution in the gene encoding myelin proteolipid protein mice. J. cell. Biochem. 13B, 181.
disrupts oligodendrocyte differentiation. /. Neurosci. 10,
NADON, N., KORN, N. AND DEMARS, R. (1988). A-ll: Cell type-
117-124.
specific and single-active-X transcription controls of newly found
GRIFFITHS, I. R., DUNCAN, I. D. AND MCCULLOCH, M. (19816).
Shaking pups: a disorder of central myelination in the spaniel gene in cultured human cells. Som. Cell and molec. Genet. 14,
dog. II. Ultrastructural observations on the white matter of the 541-552.
cervical spinal cord. J. Newocytology 10, 847-858. NAVE, K.-A., BLOOM, F. E. AND MILNER, R. J. (19876). A single
GRIFFITHS, I. R., DUNCAN, I. D., MCCULLOCH, M. AND HARVEY,
nucleotide difference in the gene for myelin proteolipid protein
M. J. A. (1981a). Shaking pups: a disorder of central defines the jimpy mutation in mouse. J. Neurochem. 49,
myelination in the spaniel dog. I. Clinical, genetic and light- 1873-1877.
microscopical observations. J. Neurol. Sci. 50, 423-433. NAVE, K.-A., LAI, C , BLOOM, F. E. AND MILNER, R. J. (1987a).
GUMPEL, M., LACHAPELLE, F., BAULAC, M., BARON VAN
Splice site selection in the proteolipid protein (PLP) gene
EVERCOOREN, A . , LUBETZKI, C , G A N S M U L L E R , A . , LOMBRAIL, P . ,
transcript and primary structure of the DM-20 protein of central
JACQUE, C. AND BAUMANN, N. (1987). Myelination in the mouse nervous system myelin. Proc. natn. Acad. Sci. U.S.A. 84,
by transplanted oligodendrocytes. In dial and Neuronal 5665-5669.
Communication in Development and Regeneration, pp. 819, (H. PUCKETT, C , HUDSON, L., ONO, K., FRIEDRICH, V., BENECKE, J.,
Althaus and W. Seifert eds.) Springer-Verlag, Berlin. DUBOIS-DALCQ, M. AND LAZZARINI, R. A. (1987). Myelin
HIGUCHI, R., VON BEROLDINGEN, C , SENSABAUGH, G. AND ERLICH, specific proteolipid protein is expressed in myelinating Schwann
H. (1988). DNA typing from single hairs. Nature 332, 543-546. cells but not incorporated into myelin sheaths. /. Neurosci. Res.
HUDSON, L. D., BERNDT, J. A., PUCKETT, C , KOZAK, C. A. AND 18, 511-518.
LAZZARINI, R. A. (1987). Aberrant splicing of proteolipid RACKWITZ, H.-R., ZEHETNER, G., FRISCHAUF, A.-M. AND
protein mRNA in the dysmyelinating jimpy mutant mouse. LEHRACH, H. (1984). Rapid restriction mapping of DNA cloned
Proc. natn. Acad. Sci. U.S.A. 84, 1454-1458. in lambda phage vectors. Gene 30, 195-200.
HUDSON, L. D., FRIEDRICH, V. L. JR, BEHAR, T., DUBOIS-DALCQ, RAFF, M. C. (1989). Glial cell diversification in the rat optic nerve.
M. AND LAZZARINI, R. A. (19896). The initial events in myelin Science 243, 1450-1455.
synthesis: orientation of proteolipid protein in the plasma ROUSSEL, G., NESKOVIC, N. M., TRIFIUEFF, E., ARTAULT, J.-C.
membrane of cultured oligodendrocytes. J. Cell Biol. 109, AND NUSSBAUM, J.-L. (1987). Arrest of proteolipid transport
717-727. through the Golgi apparatus in jimpy brain. J. Neurocytology
HUDSON, L. D. AND NADON, N. L. (1990). Amino acid 10, 195-204.
substitutions in proteolipid protein that cause dysmyelination. In SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S., HIGUCHI,
Myelin: A Treatise, (ed. R. E. Martenson). Telford Press, R., HORN, G. T., MULUS, K. B. AND ERUCH, H. A. (1988).
Caldwell NJ. Primer-directed enzymatic amplification of DNA with a
HUDSON, L. D., PUCKETT, C , BERNDT, J., CHAN, J. AND GENCIC, thermostable DNA polymerase. Science 239, 487-491.
S. (1989a). Mutation of the proteolipid protein (PLP) gene in a SIMONS, R. AND RIORDAN, J. R. (1990). The myelin deficient rat
human X-linked myelin disorder. Proc. natn. Acad. Sci. U S.A. has a single base substitution in the third exon of the myelin
86, 8128-8131. proteolipid protein gene. /. Neurochem. 54, 1079-1081.
INUZUKA, T., DUNCAN, I. D. AND QUARLES, R. H. (1986). Myelin SKOFF, R. P. (1976). Myelin deficit in the jimpy mouse may be due
proteins in the CNS of 'shaking pups'. Dev. Brain Res. 27, to cellular abnormalities in astrogha. Nature 264, 560-562.
43-50. SOUTHERN, E. M. (1975). Detection of specific sequences amongThe shaking pup is a point mutation in PLP 537 DNA fragments separated by gel electrophoresis. J. molec. Biol. WINTER, E., YAMAMOTO, F . , ALMOGUERA, C. AND PERUCHO, M. 98, 503-517. (1985). A method to detect and characterize point mutations in TABOR, S. AND RICHARDSON, C. C. (1987). DNA sequence analysis transcribed genes: amplification and overexpression of the with a modified bacteriophage T7 DNA polymerase. Proc. nam. mutant c-Ki-ras allele in human tumor cells. Proc. nam. Acad. Acad. Sci. U.S.A. 84, 4767-4771. Sci. U.S.A. 82, 7575-7579. TROFATTER, J., DLOUHY, S., DEMYER, W., CONNEALLY, P. AND WOLF, M. K., KARDON, G. B., ADCOCK, L. H. AND BILUNGS- HODES, M. (1989). Pelizaeus-Merzbacher disease: tight linkage GAGUARDI, S. (1983). Hypomyelinated mutant mice. V. to proteolipid protein (PLP) gene exon vanant. Proc. nam. Relationship between jp and jp™*1 re-examined on identical Acad. Sci. U.S.A. 86, 9427-9430. genetic backgrounds. Brain Res. 271, 121-129. VAN DORSSALAER, A., NEBHI, R., SOROKINE, O., SCHINDLER, P. YANAGISAWA, K., MOLLER, J. R., DUNCAN, I. D . AND QUARLES, AND Luu, B. (1987). The DM-20 proteolipid is a major brain R. H. (1987). Disproportional expression of proteolipid protein protein. It is synthesized earlier in fetal life than the major and DM-20 in the X-linked, dysmyelinating shaking pup mutant myelin proteolipid protein (PLP). C. R. Acad. Sci. Pans 305, J. Neurochem. 49, 1912-1917. 555-560. VERITY, A., LEVLNE, M. AND CAMPAGNONI, A. (1990). Cellular expression of MBP and PLP mRNAs in jimpy mice. Trans. Amer. Soc. Neurochem. 1, 236. (Accepted 13 July 1990)
You can also read
