ImprintRNA Immunoprecipitation (RIP) Kit - User Guide Catalog Number RIP
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
User Guide Catalog Number RIP Imprint RNA ® Immunoprecipitation (RIP) Kit
Table of Contents
RIP Kit Components and Storage ………………………………………………3
Product Description ……………………………………………………………3
Reagents and Equipment Required or Optional but not Provided…………….4
Procedure…………………………………………………………………………….6
Sample Preparation.............................………………………………...………….6
Release and Count Cells……………………………..………………….……7
Lyse Cells…………………………………………………………………….....8
RNA Immunoprecipitation (RIP)……………………………………………….…...8
RIP Option 1. RIP with Prebound Antibody .…………………..……………9
RIP Option 2. RIP with Direct Antibody Binding………………………..….11
Wash RIPs and Purify RNA ………………………………………………………12
Identify and Profile RNA…………………………………………………..………13
DNase treatment using DNase I,
amplification grade AMPD1……...……………………………………..……13
Reverse Transcription ……………………………………...…...…...………14
SYBR Green qPCR………………………………………………………...…14
Hydrolysis Probe qPCR…………………………………………………....…15
Data Analysis …………………………………………………………………..15
Expected Results ……………………………………………………………..16
Troubleshooting Guide……………………………………………………………17
References………………………………………………………………………….19
Legal Information …………………………………………………………………19
2RIP Kit Components and Storage
The RIP kit is shipped at two different temperatures. The wet ice shipment contains Part 1. The dry ice shipment
contains Part 2. Storage temperatures are indicated below.
Catalog Imprint RNA Immunoprecipitation Kit
No. Part 1 – Catalog Number RIPPART1 2-8 °C
B0314 Mild Lysis Buffer 1 x 3 mL
B0439 Harsh Lysis Buffer 1 x 3 mL
B0564 RIP Wash Buffer 2 x 75 mL
B0689 Protein A Magnetic Beads* 1 x 300 µL
I5381 IgG from mouse serum 1 x 1 mg
I5006 IgG from rabbit serum 1 x 1 mg
Catalog Imprint RNA Immunoprecipitation Kit
No. Part 2 - Catalog Number RIPPART2 −20 °C
R1158 Ribonuclease Inhibitor 1 x 2.5 KU
P8340 Protease Inhibitor Cocktail 2 x 125 µL
Anti-Mouse IgG (whole molecule)
M7023 antibody produced in rabbit 1 x 60 µL
Product Description
RNA immunoprecipitation (RIP) is a powerful technique for studying RNA binding proteins (RBPs) and their RNA
partners in ribonucleoprotein (RNP) complexes. Antibodies raised against specific RBPs are used to co-
precipitate RNPs, i.e., the RBP along with its RNA partners. The RNA can then be identified by next generation
sequencing, or if testing for a specific RNA, by RT-PCR.
The Sigma RIP kit provides all reagents needed for successful RIP except the user’s specific antibody. The kit
includes two lysis buffers, one mild for weakly bound RBPs, the other harsh for strongly associated RBPs. Protein
A magnetic beads are provided to collect immune precipitates and facilitate washing. The kit also includes both
rabbit and mouse IgG for negative control RIPs, a rabbit anti-mouse bridging antibody to bind mouse monoclonal
antibodies efficiently to protein A on the magnetic beads, as well as both protease and ribonuclease inhibitors to
protect the RNPs from degradation during RIP.
Reagents to cross-link are not provided with this kit. With many RIP targets, cross-linking is not necessary. Cross-
1
linking may reduce the efficiency of cellular lysis, increase background signal, and is not entirely reversible .
Precautions and Disclaimer
This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data
Sheet for information regarding hazards and safe handling practices.
Storage/Stability
Consult individual component labels for correct storage temperatures.
3Reagents and Equipment Required or Optional, but Not Provided
All reagents are from Sigma-Aldrich, except where noted.
Catalog
Reagent Description Number
Ammonium Acetate 5 M 09691
10X PBS P7059
TRI Reagent® T9424
Ambion
Linear Acrylamide (5 mg/ml) AM9520
B9673 or
1-Bromo-3-Chloropropane or Chloroform C2432
2-Propanol 190764
Specific Antibody Varies
Cells Varies
Trypsin-EDTA Solution T4049
DNase I, amplification grade AMPD1
DL-Dithiothreitol (DTT) (optional) D9779
Positive control antibodies (optional)
Millipore
RIPAb+ SNRNP70 - RIP Validated Antibody and Primer Set 03-103
Imprint® Monclonal Anti-Ago antibody produced in mouse, clone 2A8 SAB4800048
Monoclonal Anti-AGO2 antibody produced in rat, clone 11A9 SAB4200085
Anti-Rat IgG (whole molecule) antibody produced in rabbit R9255
IgG from rat serum I4131
Reverse Transcription Components (optional)
Nuclease-free water W1754
MMLV RT M1302
Random Nonamers R7647
Oligo dT Anchored O4387
dNTPs D7295
Ribonuclease Inhibitor R2520
MystiCq® microRNA cDNA Synthesis Mix MIRRT
qPCR Components (optional)
®
SYBR Green JumpStart™ Taq ReadyMix™ for Quantitative PCR S4438
Specific Primers for Test RNA Varies
Forward Specific Primer for U1 Positive Control RNA Target Custom
5' TCCCAGGGCGAGGCTTATCCATT 3' product
Reverse Specific Primer for U1 Positive Control RNA Target Custom
5' GAACGCAGTCCCCCACTACCACAAAT 3' product
JumpStart™Taq ReadyMix™ for Quantitative PCR D7440
MIRAP00001-
MystiCq® microRNA qPCR Assay Primer 01434
MystiCq® microRNA® SYBR® Green qPCR ReadyMix™ MIRRM00-03
4Equipment
Magnetic separator stand
Vacuum aspirator
Vortex mixer
Rotating wheel/platform
Centrifuge for cell culture
Microcentrifuge
Ultra low temperature freezer (-80 °C)
Timer
Pipettes
Nuclease-free filter pipette tips
Cell Scraper
Corning 15 ml and 50 ml tubes
Nuclease free microfuge tubes 1.5 ml and 0.5 ml
Real time thermal cycler
PCR tubes or plates, 0.2 ml
5Procedure
RIP Workflow
I. Sample Preparation
The total number of cells used per RIP must be optimized based on the abundance of the RNA-binding protein
(RBP) and its potential RNA targets. Typically one RIP (i.e., one immunoprecipitation using one antibody) requires
0.5 million to 10 million cells. However, up to 20 million cells have been used successfully. For high to moderately
abundant proteins and target RNAs, RIP can usually be performed successfully with low to moderate numbers of
cells. However, the maximum number of cells may be needed to detect rare RNAs or even moderately abundant
RNAs with rare protein partners.
6Two different lysis buffers are supplied in the kit: a mild lysis buffer and a harsh lysis buffer. The mild lysis buffer
relies on a nonionic detergent to disrupt the plasma membrane, but leaves the nuclei essentially intact. The harsh
lysis buffer includes two ionic detergents along with a nonionic detergent. This harsh lysis buffer disrupts the
nuclear membrane and also disrupts weak protein-protein and protein-RNA interactions. As a general rule, use
the mild lysis buffer unless nonspecific background binding is too high, there is a known strong interaction
between the RNA binding protein and its target RNA, or the RBP-RNA complex of interest is exclusively nuclear.
Both buffers have been used in successful RIP experiments.
At least 2 immunoprecipitations should be performed for each RIP experiment: one with antibody specific for the
RBP of interest and the second with the same amount of negative control IgG prepared from non-immune serum
of the same animal species as the RBP-specific antibody. Any RNA co-immunoprecipitated with the negative
control IgG is a non-specific product, and the amount of that RNA detected after IgG-RIP should be subtracted
from the amount detected in specific RBP RIPs. Negative control IgG from rabbit and mouse (I5006 and I5381)
are both included in the kit for this purpose. IgG from other host animals must be purchased separately. A
positive control RIP may also be performed. SNRNP70, a small nuclear ribonucleoprotein involved in pre-mRNA
splicing, and Ago2, a major component of the RNA induced silencing complex (RISC), are both abundant,
universally expressed, and make good positive control RIP targets. Millipore’s anti-SNRNP70 (catalog #03-103)
and Sigma’s anti-Ago2 (catalog # SAB4200085 and SAB4800048, purchased separately) have both been used
successfully with this kit. U1 RNA, the binding partner for SNRNP70, can be detected after SNRNP70-RIP by
RT-qPCR. Similarly, any microRNA or mRNA targeted by a miRNA that are expressed in the cells used for Ago2-
RIP can also be detected by RT-qPCR.
Samples should be on ice or at 4°C throughout the entire RIP procedure to minimize RNase activity.
A. Release and count cells
Monolayer or Adherent Cells
Release by scraping
1. Wash cells twice with a sufficient volume of ice-cold PBS to thoroughly cover the cells.
2. Scrape cells from each flask or plate in a minimal volume of ice-cold PBS using a rubber policeman.
3. Count cells and aliquot appropriate number to tubes for RIP.
4. Collect cells by centrifugation at 200 x g, 5 minutes at 4 °C, and discard the supernatant.
Release by trypsin digestion
1. Rinse adherent cells once with a sufficient volume of ice-cold PBS to thoroughly cover the cells.
2. Release cells in a sufficient volume of trypsin-EDTA solution to just cover the cells.
3. Quench trypsin with 5-10X volume of complete cell culture media.
4. Count cells.
5. Pellet the cells by centrifugation at 200 x g, 5 minutes at 4 °C.
6. Discard the supernatant and resuspend the cells in a volume of ice-cold PBS equal to the cell culture
media used after trypsin digestion.
7. Repeat centrifugation, and discard the supernatant.
8. Perform a second wash with ice-cold PBS as above, transferring the appropriate number of cells for each
RIP to separate tubes before pelleting and removing supernatant.
Suspension Cells
1. Harvest cells into a conical tube.
2. Count cells.
3. Collect cells by centrifugation at 200 x g, 5 minutes at 4 °C and discard the supernatant.
4. Resuspend the cells in ice-cold PBS to wash.
5. Repeat centrifugation, and discard the supernatant.
6. Perform a second wash with ice-cold PBS as above, transferring the appropriate number of cells for each
RIP to separate tubes before pelleting and removing supernatant.
7B. Lyse cells
Complete RIP lysis buffer contains either Mild or Harsh Lysis Buffer with protease inhibitor cocktail, ribonuclease
inhibitor, and optionally, for cells containing high levels of RNase, DTT or mercaptoethanol. Prepare the
appropriate amount of complete RIP lysis buffer for the quantity of cells harvested and the number of RIPs to be
performed. If using 0.5 to 2 x 106 cells, you will need 100 μL of complete lysis buffer per RIP. If using 2 to 10 x
106 cells per RIP, you will need 200 μL of complete lysis buffer per RIP.
1. Add Protease inhibitor cocktail and Ribonuclease inhibitor to either Mild or Harsh Lysis Buffer to make
complete lysis buffer.
Note: For cells with higher levels of RNases (such as monocytes), DTT (not supplied) may also be added
to the lysis buffer at 0.5 mM to reduce disulfide bonds in RNases that are needed for stability.2
Mercaptoethanol may be used in place of DTT. Additional Ribonuclease inhibitor may also be added if
working with cell lines known to harbor high levels of RNases (extra Ribonuclease inhibitor not supplied
with the kit).
Complete RIP Lysis Buffer Preparation
For 0.5 to 2 x 106 cells/RIP For 2 to 10 x 106 cells/RIP
Number of Required Number of Required
Reagent Volume Reactions, volume, Volume Reactions, volume
N (N x Volume) N (N x Volume)
Mild or Harsh Lysis Buffer 100 μL 200 μL
Protease Inhibitor Cocktail 1 μL 2 μL
Ribonuclease Inhibitor 0.4 μL 0.8 μL
1 M DTT (Optional; not
0.05 μL 0.1 μL
supplied with kit)
2. Add 100 μL of complete RIP lysis buffer to cell pellets containing 0.5 to 2 x 106 cells or 200 μL to cell
pellets containing 2 to 10 x 106 cells.
3. Vortex thoroughly and incubate on ice for 15 minutes.
Note: Cells in complete lysis buffer may be stored in −80 °C freezer overnight. Thaw on ice before
centrifugation below.
4. Spin lysed cells in a microcentrifuge at 4 °C, 16,000 x g for 10 minutes to pellet insoluble debris.
5. Collect supernatant, measure the volume, and remove 10% by volume for input sample. Store the input
sample at −80 °C until RIPs are completed and ready to perform RNA purification. Alternatively, 10%
input may be removed from the IgG negative control RIP before or after RIP. The input sample is used to
calculate RIP yields, and may also be used to evaluate quality of the starting RNA.
II. RNA Immunoprecipitation (RIP)
RIP relies on the use of high quality antibodies to perform immunoprecipitation of RNA-binding protein - RNA
complexes. The amount of antibody used will depend on whether it is purified or unpurified and the affinity of the
antibody for immunoprecipitation. For purified antibodies, 1-5 µg per immunoprecipitation is recommended as a
guideline. An equal amount of a negative control antibody, such as non-immune IgG from the same species,
should be used in a separate RIP to test for non-specific immunoprecipitation.
Procedures are provided for either prebinding antibodies to the magnetic beads followed by RIP, or for adding
antibodies directly to RIPs followed by binding antibody-protein-RNA complexes to the magnetic beads. If using
affinity purified antibodies, prebinding to the magnetic beads is not necessary, and these antibodies can be added
directly to cell lysates. With direct addition, the antibody and protein bind in solution, which is often more efficient,
and therefore more sensitive, than binding on a solid support. Antibody prebinding to magnetic beads, along with
subsequent wash steps, removes antibody not bound to the beads, RNases and other contaminants that may be
present in the antibody solution. This prebinding procedure is recommended for unpurified antibodies.
8Separate procedures are also provided for rabbit polyclonal and mouse or rat monoclonal antibodies. The
magnetic beads provided in the kit are coated with Protein A. Protein A binds rabbit antibodies very efficiently,
but does not bind mouse or rat antibodies very well. Therefore, a rabbit antibody raised against mouse or rat IgG
is needed as a bridge between mouse or rat monoclonal antibodies and the Protein A Magnetic Beads in the kit.
Warning: Protein A magnetic beads supplied in the kit settle extremely quickly. Thorough resuspension is
critical to aliquotting the correct amount of beads per RIP. After resuspending, immediately remove the
required amount of beads with a pipette tip immersed into the middle of the bead suspension.
RIP Option 1. RIP with Prebound Antibody
A. Prebind antibody to beads
A1. Prebinding rabbit antibodies
1. Wash Magnetic Beads
a. Aliquot 0.1 mL of RIP wash buffer to separate 1.5 mL microcentrifuge tubes for each RIP.
Note: Alternatively, if performing multiple RIPs with the same antibody, beads can be prepared in bulk by
multiplying all volumes by the number of RIPs plus a slight excess for pipetting losses.
b. Transfer 20 µL of magnetic beads suspension to each tube and vortex briefly.
c. Place tubes on a 1.5 mL microcentrifuge tube magnetic separator, remove and discard the
supernatant.
d. Repeat wash with a second 0.1 mL of RIP wash buffer.
e. Resuspend beads in 0.1 mL of RIP wash buffer
2. Bind Antibody
a. Add 1-5 µg of rabbit antibody to beads in 0.1 ml RIP wash buffer.
Antibody preparation. Before using the lyophilized mouse or rabbit IgG negative control antibodies,
vortex and gently tap the bottom of the vial on a hard surface to make sure all of the lyophilization powder
is collected at the bottom of the vial. Add 1.1 mL of 1X PBS buffer to each vial for a final concentration of
1 mg/mL. After addition of 1X PBS buffer, vortex gently to ensure proper mixing of reconstituted
lyophilized antibody.
b. Incubate with rotation for 30 minutes at room temperature.
c. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
d. Remove tubes from the magnetic stand, add 0.5 mL of RIP wash buffer to each tube, and vortex
briefly.
e. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
f. Repeat the wash steps d and e.
g. Proceed to B. Bind antibody-bead complexes to target
9A2. Prebinding mouse or rat antibodies
Note: Protein A does not bind mouse or rat antibodies efficiently. Therefore, if using a mouse or rat monoclonal
antibody, a rabbit anti-mouse or rabbit anti-rat bridging antibody must be prebound to the protein A magnetic
beads first, followed by the mouse or rat monoclonal antibody.
1. Wash magnetic beads
a. Aliquot 0.1 mL of RIP wash buffer to separate 1.5 mL microcentrifuge tubes for each RIP.
Note: Alternatively, if performing multiple RIPs with the same antibody, beads can be prepared in bulk by
multiplying all volumes by the number of RIPs plus a slight excess for pipetting losses.
b. Transfer 20 µL of magnetic beads suspension to each tube and vortex briefly.
c. Place tubes on a 1.5 mL microcentrifuge tube magnetic separator, remove and discard the
supernatant.
d. Repeat wash with a second 0.1 mL of RIP wash buffer.
e. Resuspend beads in 0.1 mL of RIP wash buffer
2. Bind bridging antibody
a. Add 1-5 µg of anti-mouse IgG antibody produced in rabbit (M7023, included in kit) to beads in 0.1 ml
RIP wash buffer.
Note: If using a rat monoclonal antibody for RIP, replace anti-mouse with anti-rat IgG antibody produced
in rabbit (not included in kit).
b. Incubate with rotation for 30 minutes at room temperature.
c. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
d. Remove tubes from the magnetic stand, add 0.5 mL of RIP wash buffer to each tube, and vortex
briefly.
e. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
f. Repeat the wash steps d and e.
g. Resuspend beads in 0.1 mL of RIP wash buffer
3. Bind specific antibody
a. Add 1-5 ug of RNA binding protein-specific antibody produced in mouse or rat.
Antibody preparation. Before using the lyophilized mouse or rabbit IgG negative control antibodies,
vortex and gently tap the bottom of the vial on a hard surface to make sure all of the lyophilization powder
is collected at the bottom of the vial. Add 1.1 mL of 1X PBS buffer to each vial for a final concentration of
1 mg/mL. After addition of 1X PBS buffer, vortex gently to ensure proper mixing of reconstituted
lyophilized antibody.
b. Incubate with rotation for 30 minutes at room temperature.
c. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
d. Remove tubes from the magnetic stand, add 0.5 mL of RIP wash buffer to each tube, and vortex
briefly.
e. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
f. Repeat the wash steps d and e.
B. Bind antibody-bead complexes to target
1. If not done previously, remove 10% of cell lysate for input sample. Store this input sample at −80 °C until
ready to perform RNA purification. The input sample is used to calculate RIP yields, and may also be
used to evaluate quality of the starting RNA. Alternatively, 10% input may be removed from the IgG
negative control RIP before or after RIP.
2. Prepare IP Buffer. See tables below for volume requirements and buffer preparation.
10IP Buffer Volume Requirements
For cells lysed in mild lysis buffer, RIP will be performed in a total volume of 0.5 mL. For cells lysed in harsh
lysis buffer, RIP will be performed in a total volume of 1 mL. IP Buffer is used to dilute the lysis buffers and
bring cell lysates to these volumes.
Component Mild Lysis Buffer Harsh Lysis Buffer
ml cell lysate 0.1 0.2 0.1 0.2
ml IP Buffer 0.4 0.3 0.9 0.8
ml Total volume 0.5 0.5 1 1
IP Buffer Preparation
Required volume,
Number of RIPs,
Reagent Volume (N x Volume from
N
table above)
Wash buffer 1 mL
Protease Inhibitor Cocktail 10 μL
RNase Inhibitor 40 U/μL 4 μL
3. Add IP Buffer and cell lysates to antibody-bead complexes according to table above.
4. Incubate with rotation at 4 °C for 3 hours to overnight.
5. Centrifuge tubes briefly and place on a magnetic separator.
6. If 10% input not previously reserved, remove 10% of supernatant from IgG negative control RIP.
7. Remove and discard supernatants
8. Proceed to section III. Wash RIPs and Purify RNA
RIP Option 2. RIP with Direct Antibody Binding
A. Bind antibody to target
1. If not done previously, remove 10% of cell lysate for input sample. Store this input sample at −80 °C until
ready to perform RNA purification. Alternatively, 10% input may be removed from the IgG negative
control RIP before or after RIP. The input sample is used to calculate RIP yields, and may also be used
to evaluate quality of the starting RNA.
2. Prepare IP Buffer. See tables below for volume requirements and buffer preparation.
IP Buffer Volume Requirements
For cells lysed in mild lysis buffer, RIP will be performed in a total volume of 0.5 mL. For cells lysed in harsh
lysis buffer, RIP will be performed in a total volume of 1 mL. IP Buffer is used to dilute the lysis buffers and
bring cell lysates to these volumes.
Component Mild Lysis Buffer Harsh Lysis Buffer
ml cell lysate 0.1 0.2 0.1 0.2
ml IP Buffer 0.4 0.3 0.9 0.8
ml Total volume 0.5 0.5 1 1
IP Buffer Preparation
Required volume,
Number of RIPs,
Reagent Volume (N x Volume from
N
table above)
Wash buffer 1 mL
Protease Inhibitor Cocktail 10 μL
RNase Inhibitor 40 U/μL 4 μL
3. Add IP Buffer and cell lysates according to table above.
4. Add 1-5 ug of RNA binding protein-specific antibody or negative control IgG
11Antibody preparation. Before using the lyophilized mouse or rabbit IgG negative control antibodies, vortex
and gently tap the bottom of the vial on a hard surface to make sure all of the lyophilization powder is
collected at the bottom of the vial. Add 1.1 mL of 1X PBS buffer to each vial for a final concentration of 1
mg/mL. After addition of 1X PBS buffer, vortex gently to ensure proper mixing of reconstituted lyophilized
antibody.
5. Incubate with rotation at 4 °C for 3 hours to overnight.
6. Add bridging antibody if needed. Add 1-5 µg of anti-mouse IgG antibody produced in rabbit (M7023,
included in kit) and incubate with rotation at 4 °C for 1 hour.
Note: If using a rat monoclonal antibody for RIP, replace anti-mouse with anti-rat IgG antibody produced
in rabbit (not included in kit).
Note: Protein A does not bind mouse or rat antibodies efficiently. Therefore, if using a mouse or rat
monoclonal antibody, a rabbit anti-mouse or rabbit anti-rat bridging antibody must be added to each IP
and incubated for one hour at 4 ºC before binding to 20 µl of washed magnetic beads.
7. Add each IP to 20 µl of washed magnetic beads and incubate with rotation at 4 ºC for 1 hour.
8. Centrifuge tubes briefly and place on a magnetic separator.
9. If 10% input not previously reserved, remove 10% of supernatant from IgG negative control RIP.
10. Remove and discard supernatants
11. Proceed to section III. Wash RIPs and Purify RNA
B. Wash magnetic beads
1. Aliquot 0.1 mL of RIP wash buffer to separate 1.5 mL microcentrifuge tubes for each RIP.
Note: Alternatively, if performing multiple RIPs, beads can be prepared in bulk. Multiply all volumes by the
number of RIPs plus a slight excess for pipetting losses.
2. Transfer 20 µL of magnetic beads suspension to each tube and vortex briefly.
3. Place tubes on a 1.5 mL microcentrifuge tube magnetic separator, remove and discard the supernatant.
4. Repeat wash with a second 0.1 mL of RIP wash buffer, remove and discard the supernatant
III. Wash RIPs and purify RNA
A. Wash RIPs
1. Add 1 mL of wash buffer to each RIP and vortex gently.
2. Spin tubes briefly, place on magnetic separator, and remove supernatants.
3. Repeat wash steps 1 and 2 until magnetic beads have been washed a total of 5 times.
4. After the last wash, resuspend in 200 μL of wash buffer.
5. Bring the 10% Input samples reserved before RIP up to a final volume of 200 μL using RIP wash buffer.
B. Purify RNA (reagents not provided)
1. Add 500 μL of TRI Reagent to each washed RIP or 10% input sample in 200 μL RIP wash buffer.
2. Add 100 μL of 1-bromo-3-chloropropane to each (chloroform may be substituted).
3. Vortex briefly and spin at 4 °C for 10 minutes at 16,000 x g.
4. Remove aqueous phase taking care not to disturb the interface or bottom organic layer, and transfer to a
new tube.
5. Add 6 μL of linear acrylamide, 60 μL of 5 M ammonium acetate and 600 μL of 2-propanol and vortex
briefly.
6. Place at −80 °C for at least one hour to precipitate the RNA. Samples may be stored overnight at −80 °C
before further processing. Thaw on ice before proceeding.
7. Centrifuge at 4 °C, 16,000 x g, for 10 minutes
128. Carefully remove the supernatant and discard.
Note: Pellets may be loose. Take care not to lose them.
9. Wash pellet once with 0.5 mL of 80% ethanol.
10. Centrifuge at 4 °C, 16,000 x g for 10 minutes.
11. Carefully remove the supernatant and discard.
12. Air dry the pellets in a laminar flow hood.
13. Resuspend pellets in 10-25 μL of RNase-free water.
14. Place on ice for immediate use or store at −80 °C.
IV. Identify and profile RNA
RNA may be detected using quantitative RT-PCR if binding targets of the RBP are known. If binding targets of the
RBP are not known, or to discover new targets, RNA may be analyzed by next generation sequencing. We
recommend amplification with SeqPlex RNA Amplification Kit (SEQR) if amounts of RNA recovered are
insufficient for direct next generation sequencing.
DNase treatment is recommended prior to reverse transcription (RT) unless all primers to be used span or flank
introns and are known not to amplify genomic DNA. DNase treatment is also recommended before SeqPlex
amplification and next generation sequencing. This will reduce the likelihood that contaminating genomic DNA is
amplified and mistaken for its RNA transcription product.
Below is an example of a reverse transcription reaction and two qPCR procedures to detect U1 RNA, an RNA that
co-purifies with positive control anti-SNRP70. The SYBR Green qPCR procedure may be used with the primers
provided with Millipore’s anti-SNRNP70, or with forward primer 5'-TCCCAGGGCGAGGCTTATCCATT-3' and
reverse primer 5'-GAACGCAGTCCCCCACTACCACAAAT-3'. The hydrolysis probe procedure may be used with
separately purchased hydrolysis, or dual labeled probe assays, such as Life Technology’s TaqMan.
A. DNase treatment using DNase I, amplification grade AMPD1
1. Combine reagents from table. Mix and centrifuge briefly.
Reagent Volume
RNA, from RIP or 1% 8 μL
input*
10X Reaction Buffer** 1 μL
DNase I** 1 μL
Total Volume 10 μL
* To make 1% Input, prepare a 1:10 dilution of the 10% Input samples in RNase free water.
**10X reaction buffer, DNase, and Stop Solution (below) are components of AMPD1
2. Incubate for 15 minutes at room temperature.
3. Add 1 μL of Stop Solution to each DNase reaction.
4. Heat at 70 °C for 10 minutes.
5. Place on ice.
13B. Reverse Transcription
1. Prepare reverse transcription (RT) mix.
Reagent Catalog No. Volume/reaction
Nuclease-free water W1754 4.75 μL
10X RT Buffer B8559* 2 μL
10 mM dNTP mix D7295 1 μL
Random nonamers** R7647 1 μL
0.25 μL of 40 U/μL Ribonuclease Inhibitor R2520 0.25 μL
1 μL MMLV (RT) or nuclease-free water for no RT controls M1427* 1 μL
Total Volume 10 μL
*Components of M1302
** Random primers must be used for reverse transcription after anti-SNRP70 RIP because the specific RNA
target, U1 snRNA, is not polyadenylated. Oligo dT primers may be used with other, polyadenylated RIP targets.
2. Combine 10 μL DNase-treated RIP or input RNA with 10 μL RT mix. Mix thoroughly and spin briefly.
3. Thermocycle as follows:
Step Temp Time
Reverse Transcription 44 °C 50 minutes
55 °C 10 minutes
Denaturation 92 °C 10 minutes
Hold 4 °C indefinite
C1. SYBR Green qPCR
1. Prepare SYBR Green qPCR mix using components from S4438 and primers described above.
Reagent Volume/reaction
Nuclease-free Water 8.25 μL
2X Ready Mix 12.5 μL
5 μM Forward Primer 1 μL
5 μM Reverse Primer 1 μL
100X ROX 0.25 μL
Total Volume 23 μL
2. Aliquot 23 μL qPCR mix per PCR tube or well of PCR plate
3. Add 2 μL of cDNA from RT reactions
4. Thermocycle as follows:
Step Temp Cycles Time
Initial Denaturation 95 °C 1 cycle 3 minutes
Denaturation 95 °C 40 cycles, read 30 seconds
Annealing 60 °C fluorescence after 30 seconds
Extension 72 °C each 30 seconds
Melt 95 °C 1 cycle 1 minute
55 °C 1 cycle 30 seconds
95 °C 1 cycle 30 seconds
14C2. Hydrolysis probe qPCR
1. Prepare qPCR mix with components from D7440 and Taqman primer-probe mix from Life Technologies.
Reagent Volume/reaction
Nuclease-free Water 4.58 μL
2X Ready Mix 10 μL
25 mM MgCl2 2.4 μL
100X ROX 0.02 μL
20X TaqMan primer-probe 1 μL
Total Volume 18 μL
2. Aliquot 18 μL qPCR mix per PCR tube or well of PCR plate
3. Add 2 μL of cDNA from RT reactions
4. Thermocycle as follows:
Step Temp Cycles Time
Initial Denaturation 94 °C 1 cycle 3 minutes
Denaturation 94 °C 15 seconds
Annealing/Extension 60 °C 40 cycles, read fluorescence after each 1 minute
Data Analysis
The qPCR run is deemed successful if no products or very high Ct’s are observed in the “no reverse
transcriptase” controls. Adjust the baseline to eliminate the minor background signal (if any) in these wells.
For SYBR green reactions, ensure that the melt curve indicates the production of a single PCR product. There
should be a single peak in each well with each primer pair.
Calculate the yield (% Input) and specificity (Fold Enrichment) of your RIP reaction by plugging your average Ct
values into the RIP-qPCR Data Analysis for % Input and Fold Enrichment Calculations shell (excel worksheet
template) provided at our website.
RIP-qPCR Data Analysis (ΔΔCt method)3, 4
i. Normalize each RIP RNA fractions’ Ct value to the Input RNA fraction Ct value for the same qPCR Assay
(ΔCt) to account for RNA sample preparation differences.
ΔCt [normalized RIP] = (Ct [RIP] – (Ct [Input] – Log2 (Input Dilution Factor)))
Where, Input Dilution Factor = (fraction of the input RNA saved)1
The default Input fraction is 1% which is a dilution factor of 100 or 6.644 cycles (i.e. log2 of 100). Thus,
subtract 6.644 from the Ct value of the 1% Input sample as mentioned in the equation above.
Average normalized RIP Ct values for replicate samples.
ii. Calculate the % Input for each RIP fraction (linear conversion of the normalized RIP ΔCt).
% Input = 100 x 2(-ΔCt [ normalized RIP])
iii. Adjust the normalized RIP fraction Ct value for the normalized background [non-specific (NS) Ab] fraction Ct
value (first ΔΔCt).
ΔΔCt [RIP/NS] = ΔCt [normalized RIP] – ΔCt [normalized NS]
iv. Calculate Assay Site IP Fold Enrichment above the sample specific background (linear conversion of the first
ΔΔCt).
Fold Enrichment = 2 (-ΔΔCt [RIP/NS])
15Expected Results
Figure 1.
RIP Lysate prepared from HeLa cells (0.75 x 106 cell equivalents per IP) were immunoprecipitated using 1 µg of
either a normal Rabbit IgG, or Millipore’s Anti-SNRP70 antibody and the Imprint RNA Immunoprecipitation Kit.
Immunoprecipitation of SNRP70-associated RNA was validated by qPCR using Control Primers, U1 snRNA.
Figure 2.
6
RIP Lysate prepared from HeLa cells (0.75 x 10 cell equivalents per IP) were immunoprecipitated using 1 µg of
either a normal mouse IgG, or Millipore’s Anti-PABPC1 antibody along with Anti-mouse antibody produced in
Rabbit and the Imprint RNA Immunoprecipitation Kit. Immunoprecipitation of PABP-associated RNA was
validated by qPCR using Control Primers, Actin B.
16Troubleshooting Guide
Observation Cause Recommended Solution
Insufficient cell number Increase number of cells used per RIP.
Check lysis efficiency by observing a 5 μL
aliquot of the lysate under a microscope. If
Insufficient cell lysis using mild lysis buffer, harsh lysis buffer
may give better results, especially if RNPs
of interest are primarily nuclear.
Check if the subclass or isotype of the
antibody is correct. Choose an antibody
Antibody does not bind native
that is qualified for use in RIP. Antibodies
protein or affinity insufficient for
recognizing native protein conformations
RIP
have the highest chance for success, i.e.,
immunoprecipitation qualified.
RBP or RNA not expressed or not
Ensure RNA binding protein of interest is
associated in the cell line or growth
expressed and binding RNA target.
conditions used
Little or no RNA detected Isopropanol pellets may be loose. Take
High RNA loss during purification care not to remove them along with
supernatant.
Make sure RNA pellet is thoroughly dried
RNA contains ethanol after the wash step during RNA purification
before adding RNase-free water.
RNA transcripts that are not polyadenylated
can not be reverse transcribed with oligo
Incorrect reverse transcription
d(T) primer (i.e. U1 snRNA). Random
primers
primers are required for these types of RNA
transcripts.
Ensure the primers are specific to the RNA
Poor qPCR primer design target sequence and amplicon size is within
90-200 bp for qPCR.
Optimize PCR conditions using purified
Incorrect PCR conditions
total RNA from the same cell type
Preamplification, such as with SeqPlex
Poor RNA sequencing Insufficient amount of RNA RNA Amplification Kit (SEQR), is likely
results recovered by RIP needed to generate sufficient cDNA from
RIP RNA for next generation sequencing.
If using mild lysis buffer, try harsh lysis
Lysis not sufficiently stringent
buffer.
Resuspend protein A magnetic beads
thoroughly by vortexing gently during the
washing steps in the RIP protocol to ensure
Insufficient washing
sufficient removal of nonspecific RNA-
protein complexes. Remove wash buffer
Little or no difference
completely.
between RIP with RBP-
specific antibody and IgG More stringent wash conditions may be
negative control used if the RBP-antibody affinity is strong.
Add 0.95% Igepal and 0.75M NaCl to the
kit’s Wash Buffer (final concentrations =
Wash buffer not sufficiently
1% Igepal, 0.9M NaCl) to prepare a more
stringent
stringent wash buffer. Alternatively, adding
urea to between 0.5 M- 3 M, or 0.1% or
less SDSor deoxycholate to the wash
buffer may reduce unwanted backgroundObservation Cause Recommended Solution
Titrate the amount of antibody used per RIP.
Determine the least amount of specific
antibody needed for optimal signal to noise
ratio. Due to a higher antibody binding capacity
Too much antibody used
of the magnetic beads supplied in the kit, a
Little or no difference
lower amount of antibody may be required for
between RIP with RBP-
optimal results compared to other magnetic
specific antibody and IgG
bead protocols.
negative control
Treat RNA with RNase-free amplification
RNA contains contaminating DNA grade DNase I before reverse transcription or
other downstream applications.
Cycle numbers in the exponential phase will
Too few PCR cycles
yield the best results.
18References:
1. Keene, J. D. et al., RIP-ChIP: the isolation and identification of mRNAs, microRNAs and protein components of
ribonucleoprotein complexes from cell extracts. Nature Protocols 1(1), 302-307 (2006).
2. Chen, Z. et al., RNase activity requires formation of disulfide bonds and is regulated by the redox stat. Plant
Mol. Biol. May:55(1), 83-96 (2004).
3. Livak, K. J. & Schmittgen, T. D., Analysis of relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) Method. Methods 25(4), 402-408 (2001).
4. Yuan, J. S. et al., Statistical analysis of real-time PCR data. BMC Bioinformatics 7:85 (2006)
Legal Information
Ambion is a registered trademark of Applera Corporation or its subsidiaries in the US and/or certain other
countries.
JumpStart and ReadyMix are trademarks of Sigma-Aldrich Co. LLC
™
Protein A Magnetic Beads* are Mag Sepharose beads from GE Healthcare. These are intended for use in
research only.
SYBR is a registered trademark of Molecular Probes, Inc.
TaqMan is a registered trademark of Roche Molecular Systems, Inc.
TRI Reagent is a registered trademark of Molecular Research Center, Inc.
CK,SB,PHC 07/13-1
2013 Sigma-Aldrich Co. LLC. All rights reserved. SIGMA-ALDRICH is a trademark of Sigma-Aldrich Co. LLC, registered in the US and other
countries. Sigma brand products are sold through Sigma-Aldrich, Inc. Purchaser must determine the suitability of the product(s) for their
particular use. Additional terms and conditions may apply. Please see product information on the Sigma-Aldrich website at
www.sigmaaldrich.com and/or on the reverse side of the invoice or packing slip.
19You can also read
