Imprint RNA Immunoprecipitation (RIP) Kit

 
 
User Guide

Catalog Number RIP




Imprint RNA          ®


Immunoprecipitation (RIP) Kit
Table of Contents

                    RIP Kit Components and Storage ………………………………………………3
                    Product Description  ……………………………………………………………3
                    Reagents and Equipment Required or Optional but not Provided…………….4

                    Procedure…………………………………………………………………………….6

                    Sample Preparation.............................………………………………...………….6
                       Release and Count Cells……………………………..………………….……7
                       Lyse Cells…………………………………………………………………….....8

                    RNA Immunoprecipitation (RIP)……………………………………………….…...8
                       RIP Option 1. RIP with Prebound Antibody .…………………..……………9
                       RIP Option 2. RIP with Direct Antibody Binding………………………..….11

                    Wash RIPs and Purify RNA ………………………………………………………12

                    Identify and Profile RNA…………………………………………………..………13
                         DNase treatment using DNase I,
                        amplification grade AMPD1……...……………………………………..……13
                        Reverse Transcription ……………………………………...…...…...………14
                       SYBR Green qPCR………………………………………………………...…14
                       Hydrolysis Probe qPCR…………………………………………………....…15

                    Data Analysis    …………………………………………………………………..15
                    Expected Results    ……………………………………………………………..16
                    Troubleshooting Guide……………………………………………………………17
                    References………………………………………………………………………….19
                    Legal Information …………………………………………………………………19




                                                                                   2
RIP Kit Components and Storage

The RIP kit is shipped at two different temperatures. The wet ice shipment contains Part 1. The dry ice shipment
contains Part 2. Storage temperatures are indicated below.

                     Catalog       Imprint RNA Immunoprecipitation Kit
                     No.           Part 1 – Catalog Number RIPPART1             2-8 °C
                     B0314        Mild Lysis Buffer                             1 x 3 mL
                     B0439        Harsh Lysis Buffer                            1 x 3 mL
                     B0564        RIP Wash Buffer                               2 x 75 mL
                     B0689        Protein A Magnetic Beads*                     1 x 300 µL
                     I5381        IgG from mouse serum                          1 x 1 mg
                     I5006        IgG from rabbit serum                         1 x 1 mg


                     Catalog       Imprint RNA Immunoprecipitation Kit
                     No.           Part 2 - Catalog Number RIPPART2              −20 °C
                     R1158         Ribonuclease Inhibitor                        1 x 2.5 KU
                     P8340         Protease Inhibitor Cocktail                   2 x 125 µL
                                   Anti-Mouse IgG (whole molecule)
                     M7023         antibody produced in rabbit                   1 x 60 µL

Product Description

RNA immunoprecipitation (RIP) is a powerful technique for studying RNA binding proteins (RBPs) and their RNA
partners in ribonucleoprotein (RNP) complexes. Antibodies raised against specific RBPs are used to co-
precipitate RNPs, i.e., the RBP along with its RNA partners. The RNA can then be identified by next generation
sequencing, or if testing for a specific RNA, by RT-PCR.

The Sigma RIP kit provides all reagents needed for successful RIP except the user’s specific antibody. The kit
includes two lysis buffers, one mild for weakly bound RBPs, the other harsh for strongly associated RBPs. Protein
A magnetic beads are provided to collect immune precipitates and facilitate washing. The kit also includes both
rabbit and mouse IgG for negative control RIPs, a rabbit anti-mouse bridging antibody to bind mouse monoclonal
antibodies efficiently to protein A on the magnetic beads, as well as both protease and ribonuclease inhibitors to
protect the RNPs from degradation during RIP.

Reagents to cross-link are not provided with this kit. With many RIP targets, cross-linking is not necessary. Cross-
                                                                                                               1
linking may reduce the efficiency of cellular lysis, increase background signal, and is not entirely reversible .

Precautions and Disclaimer
This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data
Sheet for information regarding hazards and safe handling practices.

Storage/Stability
Consult individual component labels for correct storage temperatures.




                                                                                                              3
Reagents and Equipment Required or Optional, but Not Provided
All reagents are from Sigma-Aldrich, except where noted.
                                                                             Catalog
        Reagent Description                                                  Number
         Ammonium Acetate 5 M                                                 09691
         10X PBS                                                              P7059
         TRI Reagent®                                                         T9424
                                                                              Ambion
         Linear Acrylamide (5 mg/ml)                                          AM9520
                                                                              B9673 or
         1-Bromo-3-Chloropropane or Chloroform                                C2432
         2-Propanol                                                           190764
         Specific Antibody                                                    Varies
         Cells                                                                Varies
         Trypsin-EDTA Solution                                                T4049
         DNase I, amplification grade                                         AMPD1
         DL-Dithiothreitol (DTT) (optional)                                   D9779

         Positive control antibodies (optional)
                                                                              Millipore
         RIPAb+ SNRNP70 - RIP Validated Antibody and Primer Set               03-103
         Imprint® Monclonal Anti-Ago antibody produced in mouse, clone 2A8    SAB4800048
         Monoclonal Anti-AGO2 antibody produced in rat, clone 11A9            SAB4200085
         Anti-Rat IgG (whole molecule) antibody produced in rabbit            R9255
         IgG from rat serum                                                   I4131

         Reverse Transcription Components (optional)
         Nuclease-free water                                                  W1754
         MMLV RT                                                              M1302
         Random Nonamers                                                      R7647
         Oligo dT Anchored                                                    O4387
         dNTPs                                                                D7295
         Ribonuclease Inhibitor                                               R2520
         MystiCq® microRNA cDNA Synthesis Mix                                 MIRRT

         qPCR Components (optional)
               ®
         SYBR Green JumpStart™ Taq ReadyMix™ for Quantitative PCR             S4438
         Specific Primers for Test RNA                                        Varies
         Forward Specific Primer for U1 Positive Control RNA Target           Custom
         5' TCCCAGGGCGAGGCTTATCCATT 3'                                        product
         Reverse Specific Primer for U1 Positive Control RNA Target           Custom
         5' GAACGCAGTCCCCCACTACCACAAAT 3'                                     product
         JumpStart™Taq ReadyMix™ for Quantitative PCR                         D7440
                                                                              MIRAP00001-
         MystiCq® microRNA qPCR Assay Primer                                  01434
         MystiCq® microRNA® SYBR® Green qPCR ReadyMix™                        MIRRM00-03




                                                                                            4
Equipment
Magnetic separator stand
Vacuum aspirator
Vortex mixer
Rotating wheel/platform
Centrifuge for cell culture
Microcentrifuge
Ultra low temperature freezer (-80 °C)
Timer
Pipettes
Nuclease-free filter pipette tips
Cell Scraper
Corning 15 ml and 50 ml tubes
Nuclease free microfuge tubes 1.5 ml and 0.5 ml
Real time thermal cycler
PCR tubes or plates, 0.2 ml




                                                  5
Procedure

RIP Workflow




I. Sample Preparation
The total number of cells used per RIP must be optimized based on the abundance of the RNA-binding protein
(RBP) and its potential RNA targets. Typically one RIP (i.e., one immunoprecipitation using one antibody) requires
0.5 million to 10 million cells. However, up to 20 million cells have been used successfully. For high to moderately
abundant proteins and target RNAs, RIP can usually be performed successfully with low to moderate numbers of
cells. However, the maximum number of cells may be needed to detect rare RNAs or even moderately abundant
RNAs with rare protein partners.




                                                                                                              6
Two different lysis buffers are supplied in the kit: a mild lysis buffer and a harsh lysis buffer. The mild lysis buffer
relies on a nonionic detergent to disrupt the plasma membrane, but leaves the nuclei essentially intact. The harsh
lysis buffer includes two ionic detergents along with a nonionic detergent. This harsh lysis buffer disrupts the
nuclear membrane and also disrupts weak protein-protein and protein-RNA interactions. As a general rule, use
the mild lysis buffer unless nonspecific background binding is too high, there is a known strong interaction
between the RNA binding protein and its target RNA, or the RBP-RNA complex of interest is exclusively nuclear.
Both buffers have been used in successful RIP experiments.

At least 2 immunoprecipitations should be performed for each RIP experiment: one with antibody specific for the
RBP of interest and the second with the same amount of negative control IgG prepared from non-immune serum
of the same animal species as the RBP-specific antibody. Any RNA co-immunoprecipitated with the negative
control IgG is a non-specific product, and the amount of that RNA detected after IgG-RIP should be subtracted
from the amount detected in specific RBP RIPs. Negative control IgG from rabbit and mouse (I5006 and I5381)
are both included in the kit for this purpose. IgG from other host animals must be purchased separately. A
positive control RIP may also be performed. SNRNP70, a small nuclear ribonucleoprotein involved in pre-mRNA
splicing, and Ago2, a major component of the RNA induced silencing complex (RISC), are both abundant,
universally expressed, and make good positive control RIP targets. Millipore’s anti-SNRNP70 (catalog #03-103)
and Sigma’s anti-Ago2 (catalog # SAB4200085 and SAB4800048, purchased separately) have both been used
successfully with this kit. U1 RNA, the binding partner for SNRNP70, can be detected after SNRNP70-RIP by
RT-qPCR. Similarly, any microRNA or mRNA targeted by a miRNA that are expressed in the cells used for Ago2-
RIP can also be detected by RT-qPCR.

Samples should be on ice or at 4°C throughout the entire RIP procedure to minimize RNase activity.

A. Release and count cells
 Monolayer or Adherent Cells
   Release by scraping
   1. Wash cells twice with a sufficient volume of ice-cold PBS to thoroughly cover the cells.
   2. Scrape cells from each flask or plate in a minimal volume of ice-cold PBS using a rubber policeman.
   3. Count cells and aliquot appropriate number to tubes for RIP.
   4. Collect cells by centrifugation at 200 x g, 5 minutes at 4 °C, and discard the supernatant.

    Release by trypsin digestion
    1. Rinse adherent cells once with a sufficient volume of ice-cold PBS to thoroughly cover the cells.
    2. Release cells in a sufficient volume of trypsin-EDTA solution to just cover the cells.
    3. Quench trypsin with 5-10X volume of complete cell culture media.
    4. Count cells.
    5. Pellet the cells by centrifugation at 200 x g, 5 minutes at 4 °C.
    6. Discard the supernatant and resuspend the cells in a volume of ice-cold PBS equal to the cell culture
       media used after trypsin digestion.
    7. Repeat centrifugation, and discard the supernatant.
    8. Perform a second wash with ice-cold PBS as above, transferring the appropriate number of cells for each
       RIP to separate tubes before pelleting and removing supernatant.


 Suspension Cells
   1. Harvest cells into a conical tube.
   2. Count cells.
   3. Collect cells by centrifugation at 200 x g, 5 minutes at 4 °C and discard the supernatant.
   4. Resuspend the cells in ice-cold PBS to wash.
   5. Repeat centrifugation, and discard the supernatant.
   6. Perform a second wash with ice-cold PBS as above, transferring the appropriate number of cells for each
      RIP to separate tubes before pelleting and removing supernatant.




                                                                                                                   7
B. Lyse cells
Complete RIP lysis buffer contains either Mild or Harsh Lysis Buffer with protease inhibitor cocktail, ribonuclease
inhibitor, and optionally, for cells containing high levels of RNase, DTT or mercaptoethanol. Prepare the
appropriate amount of complete RIP lysis buffer for the quantity of cells harvested and the number of RIPs to be
performed. If using 0.5 to 2 x 106 cells, you will need 100 μL of complete lysis buffer per RIP. If using 2 to 10 x
106 cells per RIP, you will need 200 μL of complete lysis buffer per RIP.

    1. Add Protease inhibitor cocktail and Ribonuclease inhibitor to either Mild or Harsh Lysis Buffer to make
       complete lysis buffer.

        Note: For cells with higher levels of RNases (such as monocytes), DTT (not supplied) may also be added
        to the lysis buffer at 0.5 mM to reduce disulfide bonds in RNases that are needed for stability.2
        Mercaptoethanol may be used in place of DTT. Additional Ribonuclease inhibitor may also be added if
        working with cell lines known to harbor high levels of RNases (extra Ribonuclease inhibitor not supplied
        with the kit).

Complete RIP Lysis Buffer Preparation

                                       For 0.5 to 2 x 106 cells/RIP                  For 2 to 10 x 106 cells/RIP
                                            Number of Required                           Number of      Required
 Reagent                         Volume Reactions, volume,                   Volume Reactions, volume
                                                 N         (N x Volume)                       N         (N x Volume)
 Mild or Harsh Lysis Buffer      100 μL                                      200 μL
 Protease Inhibitor Cocktail       1 μL                                        2 μL
 Ribonuclease Inhibitor           0.4 μL                                      0.8 μL
 1 M DTT (Optional; not
                                 0.05 μL                                      0.1 μL
 supplied with kit)

    2. Add 100 μL of complete RIP lysis buffer to cell pellets containing 0.5 to 2 x 106 cells or 200 μL to cell
       pellets containing 2 to 10 x 106 cells.
    3. Vortex thoroughly and incubate on ice for 15 minutes.
       Note: Cells in complete lysis buffer may be stored in −80 °C freezer overnight. Thaw on ice before
       centrifugation below.
    4. Spin lysed cells in a microcentrifuge at 4 °C, 16,000 x g for 10 minutes to pellet insoluble debris.
    5. Collect supernatant, measure the volume, and remove 10% by volume for input sample. Store the input
       sample at −80 °C until RIPs are completed and ready to perform RNA purification. Alternatively, 10%
       input may be removed from the IgG negative control RIP before or after RIP. The input sample is used to
       calculate RIP yields, and may also be used to evaluate quality of the starting RNA.


II. RNA Immunoprecipitation (RIP)
RIP relies on the use of high quality antibodies to perform immunoprecipitation of RNA-binding protein - RNA
complexes. The amount of antibody used will depend on whether it is purified or unpurified and the affinity of the
antibody for immunoprecipitation. For purified antibodies, 1-5 µg per immunoprecipitation is recommended as a
guideline. An equal amount of a negative control antibody, such as non-immune IgG from the same species,
should be used in a separate RIP to test for non-specific immunoprecipitation.

Procedures are provided for either prebinding antibodies to the magnetic beads followed by RIP, or for adding
antibodies directly to RIPs followed by binding antibody-protein-RNA complexes to the magnetic beads. If using
affinity purified antibodies, prebinding to the magnetic beads is not necessary, and these antibodies can be added
directly to cell lysates. With direct addition, the antibody and protein bind in solution, which is often more efficient,
and therefore more sensitive, than binding on a solid support. Antibody prebinding to magnetic beads, along with
subsequent wash steps, removes antibody not bound to the beads, RNases and other contaminants that may be
present in the antibody solution. This prebinding procedure is recommended for unpurified antibodies.


                                                                                                                   8
Separate procedures are also provided for rabbit polyclonal and mouse or rat monoclonal antibodies. The
magnetic beads provided in the kit are coated with Protein A. Protein A binds rabbit antibodies very efficiently,
but does not bind mouse or rat antibodies very well. Therefore, a rabbit antibody raised against mouse or rat IgG
is needed as a bridge between mouse or rat monoclonal antibodies and the Protein A Magnetic Beads in the kit.

Warning: Protein A magnetic beads supplied in the kit settle extremely quickly. Thorough resuspension is
critical to aliquotting the correct amount of beads per RIP. After resuspending, immediately remove the
required amount of beads with a pipette tip immersed into the middle of the bead suspension.


RIP Option 1. RIP with Prebound Antibody
A. Prebind antibody to beads

A1. Prebinding rabbit antibodies

    1. Wash Magnetic Beads
       a. Aliquot 0.1 mL of RIP wash buffer to separate 1.5 mL microcentrifuge tubes for each RIP.
       Note: Alternatively, if performing multiple RIPs with the same antibody, beads can be prepared in bulk by
       multiplying all volumes by the number of RIPs plus a slight excess for pipetting losses.

        b. Transfer 20 µL of magnetic beads suspension to each tube and vortex briefly.
        c. Place tubes on a 1.5 mL microcentrifuge tube magnetic separator, remove and discard the
           supernatant.
        d. Repeat wash with a second 0.1 mL of RIP wash buffer.
        e. Resuspend beads in 0.1 mL of RIP wash buffer

    2. Bind Antibody
       a. Add 1-5 µg of rabbit antibody to beads in 0.1 ml RIP wash buffer.

        Antibody preparation. Before using the lyophilized mouse or rabbit IgG negative control antibodies,
        vortex and gently tap the bottom of the vial on a hard surface to make sure all of the lyophilization powder
        is collected at the bottom of the vial. Add 1.1 mL of 1X PBS buffer to each vial for a final concentration of
        1 mg/mL. After addition of 1X PBS buffer, vortex gently to ensure proper mixing of reconstituted
        lyophilized antibody.

        b. Incubate with rotation for 30 minutes at room temperature.
        c. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
        d. Remove tubes from the magnetic stand, add 0.5 mL of RIP wash buffer to each tube, and vortex
           briefly.
        e. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
        f. Repeat the wash steps d and e.
        g. Proceed to B. Bind antibody-bead complexes to target




                                                                                                               9
A2. Prebinding mouse or rat antibodies
Note: Protein A does not bind mouse or rat antibodies efficiently. Therefore, if using a mouse or rat monoclonal
antibody, a rabbit anti-mouse or rabbit anti-rat bridging antibody must be prebound to the protein A magnetic
beads first, followed by the mouse or rat monoclonal antibody.

    1. Wash magnetic beads
       a. Aliquot 0.1 mL of RIP wash buffer to separate 1.5 mL microcentrifuge tubes for each RIP.
       Note: Alternatively, if performing multiple RIPs with the same antibody, beads can be prepared in bulk by
       multiplying all volumes by the number of RIPs plus a slight excess for pipetting losses.

         b. Transfer 20 µL of magnetic beads suspension to each tube and vortex briefly.
         c. Place tubes on a 1.5 mL microcentrifuge tube magnetic separator, remove and discard the
            supernatant.
         d. Repeat wash with a second 0.1 mL of RIP wash buffer.
         e. Resuspend beads in 0.1 mL of RIP wash buffer

    2. Bind bridging antibody
       a. Add 1-5 µg of anti-mouse IgG antibody produced in rabbit (M7023, included in kit) to beads in 0.1 ml
            RIP wash buffer.
       Note: If using a rat monoclonal antibody for RIP, replace anti-mouse with anti-rat IgG antibody produced
       in rabbit (not included in kit).

         b. Incubate with rotation for 30 minutes at room temperature.
         c. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
         d. Remove tubes from the magnetic stand, add 0.5 mL of RIP wash buffer to each tube, and vortex
            briefly.
         e. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
         f. Repeat the wash steps d and e.
         g. Resuspend beads in 0.1 mL of RIP wash buffer

    3.    Bind specific antibody
         a. Add 1-5 ug of RNA binding protein-specific antibody produced in mouse or rat.

         Antibody preparation. Before using the lyophilized mouse or rabbit IgG negative control antibodies,
         vortex and gently tap the bottom of the vial on a hard surface to make sure all of the lyophilization powder
         is collected at the bottom of the vial. Add 1.1 mL of 1X PBS buffer to each vial for a final concentration of
         1 mg/mL. After addition of 1X PBS buffer, vortex gently to ensure proper mixing of reconstituted
         lyophilized antibody.

         b. Incubate with rotation for 30 minutes at room temperature.
         c. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
         d. Remove tubes from the magnetic stand, add 0.5 mL of RIP wash buffer to each tube, and vortex
            briefly.
         e. Centrifuge tubes briefly, place on a magnetic separator, remove and discard the supernatant.
         f. Repeat the wash steps d and e.


B. Bind antibody-bead complexes to target

    1. If not done previously, remove 10% of cell lysate for input sample. Store this input sample at −80 °C until
       ready to perform RNA purification. The input sample is used to calculate RIP yields, and may also be
       used to evaluate quality of the starting RNA. Alternatively, 10% input may be removed from the IgG
       negative control RIP before or after RIP.
    2. Prepare IP Buffer. See tables below for volume requirements and buffer preparation.



                                                                                                               10
IP Buffer Volume Requirements
    For cells lysed in mild lysis buffer, RIP will be performed in a total volume of 0.5 mL. For cells lysed in harsh
    lysis buffer, RIP will be performed in a total volume of 1 mL. IP Buffer is used to dilute the lysis buffers and
    bring cell lysates to these volumes.

                   Component               Mild Lysis Buffer      Harsh Lysis Buffer
                  ml cell lysate           0.1         0.2         0.1         0.2
                  ml IP Buffer             0.4         0.3         0.9         0.8
                 ml Total volume           0.5         0.5          1           1

    IP Buffer Preparation
                                                                                   Required volume,
                                                               Number of RIPs,
             Reagent                           Volume                                (N x Volume from
                                                                    N
                                                                                       table above)
             Wash buffer                         1 mL
             Protease Inhibitor Cocktail         10 μL
             RNase Inhibitor 40 U/μL             4 μL

    3.   Add IP Buffer and cell lysates to antibody-bead complexes according to table above.
    4.   Incubate with rotation at 4 °C for 3 hours to overnight.
    5.   Centrifuge tubes briefly and place on a magnetic separator.
    6.   If 10% input not previously reserved, remove 10% of supernatant from IgG negative control RIP.
    7.   Remove and discard supernatants
    8.   Proceed to section III. Wash RIPs and Purify RNA

RIP Option 2. RIP with Direct Antibody Binding
A. Bind antibody to target
   1. If not done previously, remove 10% of cell lysate for input sample. Store this input sample at −80 °C until
      ready to perform RNA purification. Alternatively, 10% input may be removed from the IgG negative
      control RIP before or after RIP. The input sample is used to calculate RIP yields, and may also be used
      to evaluate quality of the starting RNA.
   2. Prepare IP Buffer. See tables below for volume requirements and buffer preparation.

    IP Buffer Volume Requirements
    For cells lysed in mild lysis buffer, RIP will be performed in a total volume of 0.5 mL. For cells lysed in harsh
    lysis buffer, RIP will be performed in a total volume of 1 mL. IP Buffer is used to dilute the lysis buffers and
    bring cell lysates to these volumes.

                   Component               Mild Lysis Buffer      Harsh Lysis Buffer
                  ml cell lysate           0.1         0.2         0.1         0.2
                  ml IP Buffer             0.4         0.3         0.9         0.8
                 ml Total volume           0.5         0.5          1           1


    IP Buffer Preparation
                                                                                   Required volume,
                                                               Number of RIPs,
             Reagent                           Volume                                (N x Volume from
                                                                    N
                                                                                       table above)
             Wash buffer                         1 mL
             Protease Inhibitor Cocktail         10 μL
             RNase Inhibitor 40 U/μL             4 μL

    3. Add IP Buffer and cell lysates according to table above.
    4. Add 1-5 ug of RNA binding protein-specific antibody or negative control IgG

                                                                                                                11
Antibody preparation. Before using the lyophilized mouse or rabbit IgG negative control antibodies, vortex
     and gently tap the bottom of the vial on a hard surface to make sure all of the lyophilization powder is
     collected at the bottom of the vial. Add 1.1 mL of 1X PBS buffer to each vial for a final concentration of 1
     mg/mL. After addition of 1X PBS buffer, vortex gently to ensure proper mixing of reconstituted lyophilized
     antibody.

     5. Incubate with rotation at 4 °C for 3 hours to overnight.
     6. Add bridging antibody if needed. Add 1-5 µg of anti-mouse IgG antibody produced in rabbit (M7023,
        included in kit) and incubate with rotation at 4 °C for 1 hour.

           Note: If using a rat monoclonal antibody for RIP, replace anti-mouse with anti-rat IgG antibody produced
           in rabbit (not included in kit).

           Note: Protein A does not bind mouse or rat antibodies efficiently. Therefore, if using a mouse or rat
           monoclonal antibody, a rabbit anti-mouse or rabbit anti-rat bridging antibody must be added to each IP
           and incubated for one hour at 4 ºC before binding to 20 µl of washed magnetic beads.

     7.    Add each IP to 20 µl of washed magnetic beads and incubate with rotation at 4 ºC for 1 hour.
     8.    Centrifuge tubes briefly and place on a magnetic separator.
     9.    If 10% input not previously reserved, remove 10% of supernatant from IgG negative control RIP.
     10.   Remove and discard supernatants
     11.   Proceed to section III. Wash RIPs and Purify RNA

B. Wash magnetic beads
   1. Aliquot 0.1 mL of RIP wash buffer to separate 1.5 mL microcentrifuge tubes for each RIP.
   Note: Alternatively, if performing multiple RIPs, beads can be prepared in bulk. Multiply all volumes by the
   number of RIPs plus a slight excess for pipetting losses.

     2. Transfer 20 µL of magnetic beads suspension to each tube and vortex briefly.
     3. Place tubes on a 1.5 mL microcentrifuge tube magnetic separator, remove and discard the supernatant.
     4. Repeat wash with a second 0.1 mL of RIP wash buffer, remove and discard the supernatant




III. Wash RIPs and purify RNA
A. Wash RIPs
   1. Add 1 mL of wash buffer to each RIP and vortex gently.
   2. Spin tubes briefly, place on magnetic separator, and remove supernatants.
   3. Repeat wash steps 1 and 2 until magnetic beads have been washed a total of 5 times.
   4. After the last wash, resuspend in 200 μL of wash buffer.
   5. Bring the 10% Input samples reserved before RIP up to a final volume of 200 μL using RIP wash buffer.

B.    Purify RNA (reagents not provided)
     1. Add 500 μL of TRI Reagent to each washed RIP or 10% input sample in 200 μL RIP wash buffer.
     2. Add 100 μL of 1-bromo-3-chloropropane to each (chloroform may be substituted).
     3. Vortex briefly and spin at 4 °C for 10 minutes at 16,000 x g.
     4. Remove aqueous phase taking care not to disturb the interface or bottom organic layer, and transfer to a
         new tube.
     5. Add 6 μL of linear acrylamide, 60 μL of 5 M ammonium acetate and 600 μL of 2-propanol and vortex
         briefly.
     6. Place at −80 °C for at least one hour to precipitate the RNA. Samples may be stored overnight at −80 °C
         before further processing. Thaw on ice before proceeding.
     7. Centrifuge at 4 °C, 16,000 x g, for 10 minutes

                                                                                                              12
8. Carefully remove the supernatant and discard.
    Note: Pellets may be loose. Take care not to lose them.

    9.    Wash pellet once with 0.5 mL of 80% ethanol.
    10.   Centrifuge at 4 °C, 16,000 x g for 10 minutes.
    11.   Carefully remove the supernatant and discard.
    12.   Air dry the pellets in a laminar flow hood.
    13.   Resuspend pellets in 10-25 μL of RNase-free water.
    14.   Place on ice for immediate use or store at −80 °C.


IV. Identify and profile RNA
RNA may be detected using quantitative RT-PCR if binding targets of the RBP are known. If binding targets of the
RBP are not known, or to discover new targets, RNA may be analyzed by next generation sequencing. We
recommend amplification with SeqPlex RNA Amplification Kit (SEQR) if amounts of RNA recovered are
insufficient for direct next generation sequencing.

DNase treatment is recommended prior to reverse transcription (RT) unless all primers to be used span or flank
introns and are known not to amplify genomic DNA. DNase treatment is also recommended before SeqPlex
amplification and next generation sequencing. This will reduce the likelihood that contaminating genomic DNA is
amplified and mistaken for its RNA transcription product.

Below is an example of a reverse transcription reaction and two qPCR procedures to detect U1 RNA, an RNA that
co-purifies with positive control anti-SNRP70. The SYBR Green qPCR procedure may be used with the primers
provided with Millipore’s anti-SNRNP70, or with forward primer 5'-TCCCAGGGCGAGGCTTATCCATT-3' and
reverse primer 5'-GAACGCAGTCCCCCACTACCACAAAT-3'. The hydrolysis probe procedure may be used with
separately purchased hydrolysis, or dual labeled probe assays, such as Life Technology’s TaqMan.



A. DNase treatment using DNase I, amplification grade AMPD1

    1. Combine reagents from table. Mix and centrifuge briefly.

          Reagent                 Volume
          RNA, from RIP or 1%     8 μL
          input*
          10X Reaction Buffer**   1 μL

        DNase I**                1 μL
        Total Volume             10 μL
    * To make 1% Input, prepare a 1:10 dilution of the 10% Input samples in RNase free water.
    **10X reaction buffer, DNase, and Stop Solution (below) are components of AMPD1

    2.    Incubate for 15 minutes at room temperature.
    3.    Add 1 μL of Stop Solution to each DNase reaction.
    4.    Heat at 70 °C for 10 minutes.
    5.    Place on ice.




                                                                                                         13
B. Reverse Transcription
   1. Prepare reverse transcription (RT) mix.

         Reagent                                                      Catalog No. Volume/reaction
         Nuclease-free water                                            W1754            4.75 μL
         10X RT Buffer                                                  B8559*             2 μL
         10 mM dNTP mix                                                 D7295              1 μL
         Random nonamers**                                              R7647              1 μL
         0.25 μL of 40 U/μL Ribonuclease Inhibitor                      R2520            0.25 μL
         1 μL MMLV (RT) or nuclease-free water for no RT controls       M1427*             1 μL
         Total Volume                                                                     10 μL
*Components of M1302
** Random primers must be used for reverse transcription after anti-SNRP70 RIP because the specific RNA
target, U1 snRNA, is not polyadenylated. Oligo dT primers may be used with other, polyadenylated RIP targets.

   2. Combine 10 μL DNase-treated RIP or input RNA with 10 μL RT mix. Mix thoroughly and spin briefly.
   3. Thermocycle as follows:

       Step                                  Temp        Time
       Reverse Transcription                 44 °C       50 minutes
                                             55 °C       10 minutes
       Denaturation                          92 °C       10 minutes
       Hold                                   4 °C       indefinite



C1. SYBR Green qPCR
    1. Prepare SYBR Green qPCR mix using components from S4438 and primers described above.

       Reagent                         Volume/reaction
       Nuclease-free Water                 8.25 μL
       2X Ready Mix                        12.5 μL
       5 μM Forward Primer                   1 μL
       5 μM Reverse Primer                   1 μL
       100X ROX                            0.25 μL
       Total Volume                         23 μL

   2. Aliquot 23 μL qPCR mix per PCR tube or well of PCR plate
   3. Add 2 μL of cDNA from RT reactions
   4. Thermocycle as follows:

       Step                    Temp    Cycles                 Time
       Initial Denaturation    95 °C   1 cycle                3 minutes
       Denaturation            95 °C   40 cycles, read        30 seconds
       Annealing               60 °C   fluorescence after     30 seconds
       Extension               72 °C   each                   30 seconds
       Melt                    95 °C   1 cycle                1 minute
                               55 °C   1 cycle                30 seconds
                               95 °C   1 cycle                30 seconds




                                                                                                         14
C2. Hydrolysis probe qPCR
   1. Prepare qPCR mix with components from D7440 and Taqman primer-probe mix from Life Technologies.

          Reagent                          Volume/reaction
          Nuclease-free Water                  4.58 μL
          2X Ready Mix                          10 μL
          25 mM MgCl2                          2.4 μL
          100X ROX                             0.02 μL
          20X TaqMan primer-probe                1 μL
          Total Volume                          18 μL

      2. Aliquot 18 μL qPCR mix per PCR tube or well of PCR plate
      3. Add 2 μL of cDNA from RT reactions
      4. Thermocycle as follows:

          Step                     Temp       Cycles                                       Time
          Initial Denaturation     94 °C      1 cycle                                      3 minutes
          Denaturation             94 °C                                                   15 seconds
          Annealing/Extension      60 °C      40 cycles, read fluorescence after each      1 minute

Data Analysis
The qPCR run is deemed successful if no products or very high Ct’s are observed in the “no reverse
transcriptase” controls. Adjust the baseline to eliminate the minor background signal (if any) in these wells.

For SYBR green reactions, ensure that the melt curve indicates the production of a single PCR product. There
should be a single peak in each well with each primer pair.

Calculate the yield (% Input) and specificity (Fold Enrichment) of your RIP reaction by plugging your average Ct
values into the RIP-qPCR Data Analysis for % Input and Fold Enrichment Calculations shell (excel worksheet
template) provided at our website.

RIP-qPCR Data Analysis (ΔΔCt method)3, 4
i. Normalize each RIP RNA fractions’ Ct value to the Input RNA fraction Ct value for the same qPCR Assay
   (ΔCt) to account for RNA sample preparation differences.

      ΔCt [normalized RIP] = (Ct [RIP] – (Ct [Input] – Log2 (Input Dilution Factor)))

      Where, Input Dilution Factor = (fraction of the input RNA saved)1

      The default Input fraction is 1% which is a dilution factor of 100 or 6.644 cycles (i.e. log2 of 100). Thus,
      subtract 6.644 from the Ct value of the 1% Input sample as mentioned in the equation above.

      Average normalized RIP Ct values for replicate samples.

ii.   Calculate the % Input for each RIP fraction (linear conversion of the normalized RIP ΔCt).

                                    % Input = 100 x 2(-ΔCt [ normalized RIP])

iii. Adjust the normalized RIP fraction Ct value for the normalized background [non-specific (NS) Ab] fraction Ct
     value (first ΔΔCt).
                           ΔΔCt [RIP/NS] = ΔCt [normalized RIP] – ΔCt [normalized NS]

iv. Calculate Assay Site IP Fold Enrichment above the sample specific background (linear conversion of the first
    ΔΔCt).
                                       Fold Enrichment = 2 (-ΔΔCt [RIP/NS])


                                                                                                                     15
Expected Results

Figure 1.




RIP Lysate prepared from HeLa cells (0.75 x 106 cell equivalents per IP) were immunoprecipitated using 1 µg of
either a normal Rabbit IgG, or Millipore’s Anti-SNRP70 antibody and the Imprint RNA Immunoprecipitation Kit.
Immunoprecipitation of SNRP70-associated RNA was validated by qPCR using Control Primers, U1 snRNA.


Figure 2.




                                               6
 RIP Lysate prepared from HeLa cells (0.75 x 10 cell equivalents per IP) were immunoprecipitated using 1 µg of
either a normal mouse IgG, or Millipore’s Anti-PABPC1 antibody along with Anti-mouse antibody produced in
Rabbit and the Imprint RNA Immunoprecipitation Kit. Immunoprecipitation of PABP-associated RNA was
validated by qPCR using Control Primers, Actin B.


                                                                                                         16
Troubleshooting Guide

Observation                 Cause                                   Recommended Solution
                            Insufficient cell number                Increase number of cells used per RIP.
                                                                    Check lysis efficiency by observing a 5 μL
                                                                    aliquot of the lysate under a microscope. If
                            Insufficient cell lysis                 using mild lysis buffer, harsh lysis buffer
                                                                    may give better results, especially if RNPs
                                                                    of interest are primarily nuclear.
                                                                    Check if the subclass or isotype of the
                                                                    antibody is correct. Choose an antibody
                            Antibody does not bind native
                                                                    that is qualified for use in RIP. Antibodies
                            protein or affinity insufficient for
                                                                    recognizing native protein conformations
                            RIP
                                                                    have the highest chance for success, i.e.,
                                                                    immunoprecipitation qualified.
                            RBP or RNA not expressed or not
                                                                    Ensure RNA binding protein of interest is
                            associated in the cell line or growth
                                                                    expressed and binding RNA target.
                            conditions used
Little or no RNA detected                                           Isopropanol pellets may be loose. Take
                            High RNA loss during purification       care not to remove them along with
                                                                    supernatant.
                                                                    Make sure RNA pellet is thoroughly dried
                            RNA contains ethanol                    after the wash step during RNA purification
                                                                    before adding RNase-free water.
                                                                    RNA transcripts that are not polyadenylated
                                                                    can not be reverse transcribed with oligo
                            Incorrect reverse transcription
                                                                    d(T) primer (i.e. U1 snRNA). Random
                            primers
                                                                    primers are required for these types of RNA
                                                                    transcripts.
                                                                    Ensure the primers are specific to the RNA
                            Poor qPCR primer design                 target sequence and amplicon size is within
                                                                    90-200 bp for qPCR.
                                                                    Optimize PCR conditions using purified
                            Incorrect PCR conditions
                                                                    total RNA from the same cell type
                                                                    Preamplification, such as with SeqPlex
Poor RNA sequencing         Insufficient amount of RNA              RNA Amplification Kit (SEQR), is likely
results                     recovered by RIP                        needed to generate sufficient cDNA from
                                                                    RIP RNA for next generation sequencing.
                                                                    If using mild lysis buffer, try harsh lysis
                            Lysis not sufficiently stringent
                                                                    buffer.
                                                                    Resuspend protein A magnetic beads
                                                                    thoroughly by vortexing gently during the
                                                                    washing steps in the RIP protocol to ensure
                            Insufficient washing
                                                                    sufficient removal of nonspecific RNA-
                                                                    protein complexes. Remove wash buffer
Little or no difference
                                                                    completely.
between RIP with RBP-
specific antibody and IgG                                           More stringent wash conditions may be
negative control                                                     used if the RBP-antibody affinity is strong.
                                                                     Add 0.95% Igepal and 0.75M NaCl to the
                                                                     kit’s Wash Buffer (final concentrations =
                            Wash buffer not sufficiently
                                                                     1% Igepal, 0.9M NaCl) to prepare a more
                            stringent
                                                                     stringent wash buffer. Alternatively, adding
                                                                     urea to between 0.5 M- 3 M, or 0.1% or
                                                                     less SDSor deoxycholate to the wash
                                                                     buffer may reduce unwanted background
Observation                 Cause                            Recommended Solution
                                                             Titrate the amount of antibody used per RIP.
                                                             Determine the least amount of specific
                                                             antibody needed for optimal signal to noise
                                                             ratio. Due to a higher antibody binding capacity
                            Too much antibody used
                                                             of the magnetic beads supplied in the kit, a
Little or no difference
                                                             lower amount of antibody may be required for
between RIP with RBP-
                                                             optimal results compared to other magnetic
specific antibody and IgG
                                                             bead protocols.
negative control
                                                             Treat RNA with RNase-free amplification
                            RNA contains contaminating DNA   grade DNase I before reverse transcription or
                                                             other downstream applications.
                                                             Cycle numbers in the exponential phase will
                            Too few PCR cycles
                                                             yield the best results.




                                                                                                      18
References:
1. Keene, J. D. et al., RIP-ChIP: the isolation and identification of mRNAs, microRNAs and protein components of
   ribonucleoprotein complexes from cell extracts. Nature Protocols 1(1), 302-307 (2006).
2. Chen, Z. et al., RNase activity requires formation of disulfide bonds and is regulated by the redox stat. Plant
   Mol. Biol. May:55(1), 83-96 (2004).
3. Livak, K. J. & Schmittgen, T. D., Analysis of relative gene expression data using real-time quantitative PCR and
   the 2(-Delta Delta C(T)) Method. Methods 25(4), 402-408 (2001).
4. Yuan, J. S. et al., Statistical analysis of real-time PCR data. BMC Bioinformatics 7:85 (2006)


Legal Information
Ambion is a registered trademark of Applera Corporation or its subsidiaries in the US and/or certain other
countries.
JumpStart and ReadyMix are trademarks of Sigma-Aldrich Co. LLC
                                              ™
Protein A Magnetic Beads* are Mag Sepharose beads from GE Healthcare. These are intended for use in
research only.
SYBR is a registered trademark of Molecular Probes, Inc.
TaqMan is a registered trademark of Roche Molecular Systems, Inc.
TRI Reagent is a registered trademark of Molecular Research Center, Inc.

                                                                                                                  CK,SB,PHC 07/13-1




2013 Sigma-Aldrich Co. LLC. All rights reserved. SIGMA-ALDRICH is a trademark of Sigma-Aldrich Co. LLC, registered in the US and other
  countries. Sigma brand products are sold through Sigma-Aldrich, Inc. Purchaser must determine the suitability of the product(s) for their
         particular use. Additional terms and conditions may apply. Please see product information on the Sigma-Aldrich website at
                                www.sigmaaldrich.com and/or on the reverse side of the invoice or packing slip.



                                                                                                                                   19
You can also read
Next part ... Cancel