Regulatory Element by Guanine and Adenine Ligation-Mediated Polymerase Chain Reaction
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, May 1992, p. 2135-2142 Vol. 12, No. 5
0270-7306/92/052135-08$02.00/O
Copyright C© 1992, American Society for Microbiology
In Vivo Footprinting of the Human o-Globin Locus Upstream
Regulatory Element by Guanine and Adenine Ligation-
Mediated Polymerase Chain Reaction
ERICH C. STRAUSS,"12 NANCY C. ANDREWS,' DOUGLAS R. HIGGS,3 AND STUART H. ORKIN',3*
Division of Hematology/Oncology, Children's Hospital and the Dana-Farber Cancer Institute, and Department of
Pediatrics, Harvard Medical School,' Harvard-MIT Division of Health Sciences and Technology, 2 and
Howard Hughes Medical Institute, 3 Boston, Massachusetts 02115, and MRC Molecular Haematology
Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, England4
Received 4 November 1991/Accepted 12 February 1992
Downloaded from http://mcb.asm.org/ on March 1, 2021 by guest
A major regulatory element required for expression of the human ao-globin genes is located 40 kb upstream
of the embryonic C-globin gene. To understand how this and other locus control region (LCR) elements
contribute to high-level expression in erythroid cells, we have performed high-resolution, in vivo dimethyl
sulfate footprinting. In addition, we have modified the dimethyl sulfate-based ligation-mediated polymerase
chain reaction in vivo footprinting procedure to permit the assessment of interactions at guanine and adenine
residues, rather than guanines alone. In vivo footprinting of the human ca-LCR element carried on chromosome
16 in a mouse erythroleukemia cell environment revealed protein occupancy at GATA-1, AP-1/NF-E2, and
CACC/GGTGG motifs, specific differences compared with in vitro protein binding, and distinct changes in one
region upon dimethyl sulfoxide-induced cellular maturation. No protein contacts were detected in nonexpress-
ing hepatoma cells. In addition, we have demonstrated that two AP-1 motifs in the a-LCR element which are
occupied in vivo bind purified mouse NF-E2 protein in vitro. Our data suggest that three proteins, GATA-1,
NF-E2, and unknown CACC/GGTGG factors, are minimally required as DNA-binding proteins for the
function of LCR-like elements. The juxtaposition and interaction of these factors with each other, and with
accessory proteins not directly in contact with DNA, are likely to account for the relative position independence
of the upstream globin regulatory elements.
Expression of ox- and ,-like globin genes in developing ,B-globin clusters in thalassemic individuals with deletions
erythroid cells is dependent on the integrity of distant, encompassing these upstream regulatory elements provides
upstream regulatory elements, termed locus control regions conclusive evidence of their role in vivo (7, 13).
(LCRs) (reviewed in reference 28). As first shown in studies The functional activity of LCR elements is thought to be
of the human ,-globin gene complex, the LCR corresponds mediated through their interaction with both cell-specific and
to a region of chromatin exhibiting erythroid-specific DNase ubiquitous nuclear proteins, perhaps in chromatin regions
I hypersensitivity (36). Linkage of the 13-LCR to globin, or associated with nuclear matrix. To investigate the properties
unrelated, genes permits high-level, position-independent of LCR elements and the basis of cell-specific gene expres-
erythroid expression of the linked gene in transgenic mice or sion, DNA binding of nuclear proteins has been examined in
cultured cells (12). Indirect evidence suggests that the LCR vitro (15, 22, 26, 27, 30, 31, 33, 34). These studies have
acts in synergy with promoter sequences to enhance tran- revealed multiple binding sites of several types that include
scription (2). Competition of individual genes in the 3-globin motifs which bind the erythroid transcription factor GATA-1
cluster for productive interactions with the ,B-LCR may (reviewed in reference 28) (or closely related family mem-
contribute to differential regulation of the human fetal and bers [37]), AP-1 and/or the erythroid AP-1 like activity (15,
adult globin (-y- and P-globin) genes (5, 8). Within the entire 22, 26, 27, 30, 34) termed NF-E2 (21), and proteins recog-
P-LCR, discrete regions of approximately 250 to 500 bp nizing CACC or GGTGG sequences (30, 33). However, in
encompassing the individual hypersensitive sites display vitro studies are limited in several respects. They may detect
partial activity (30, 31, 34). Interspecies sequence compari- binding to sites that are unavailable in native chromatin and
sons demonstrate extraordinary sequence and spatial con- fail to reveal sites which bind proteins that are present in low
servation of these P-LCR segments in humans, mice, and concentrations in nuclear extracts or are displaced by more
goats (16, 23). Recently, Higgs and colleagues have identi- abundant proteins with overlapping specificities. Further-
fied a region located 40 kb upstream of the embryonic more, in vitro analysis is insensitive to chromatin structure.
4-globin gene that appears to serve as an LCR-like element For these reasons, we have used in vivo dimethyl sulfate
for the ot-globin cluster (14, 15). Like the 1-LCR, this (DMS) footprinting (9, 25) as a complementary method for
element is associated with erythroid-specific DNase I hyper- dissection of LCR elements. In an effort to derive maximal
sensitivity, and it is capable of directing high-level a-globin insights from this approach, we have analyzed a 350-bp
gene expression in stable erythroid cell lines and transgenic region that appears to contain the major upstream regulatory
mice (14, 15). The inactivation of genes within the ax- or activity of the ao-globin cluster (14, 15). In addition, we have
modified the ligation-mediated polymerase chain reaction
(LMPCR) in vivo footprinting procedure of Mueller and
*
Corresponding author. Wold (25) to permit the analysis of DNA-protein interactions
21352136 STRAUSS ET AL. MOL. CELL. BIOL.
at both guanine and adenine residues, rather than at guanines Guanine-specific piperidine cleavage of in vivo-methyl-
alone; we term this modified method GA-LMPCR in vivo ated DNA was done according to Maxam and Gilbert (18).
footprinting. Piperidine cleavage products were precipitated in 0.3 M
GA-LMPCR in vivo footprinting detects occupancy of sodium acetate with 2.5 volumes of ethanol. Trace amounts
specific protein binding sites in the a-globin regulatory of piperidine were removed by repeated lyophilizations in a
element. The in vivo usage of binding sites differs in detail SpeedVac concentrator. Guanine-specific cleavage products
from the pattern of proteins binding to naked DNA in vitro, were resuspended in water at approximately 1 ,ug/ul.
and our results highlight a subregion that may reflect local- In vivo footprinting. LMPCR genomic footprinting was
ized alterations of chromatin structure upon induction of performed essentially as described by Mueller and Wold
erythroid maturation. With our demonstration that the eryth- (25). After exponential amplification of the ligation products,
roid factor NF-E2 can bind the AP-1 motifs of the a-globin the 100-pA reaction volume was transferred to a 1.5-ml tube
regulatory element, the composite in vitro and in vivo data containing 295 pA of Taq stop buffer (260 mM sodium acetate
allow us to infer that GATA-1, NF-E2, and unknown CACC/ [pH 7.0], 10 mM Tris-HCI [pH 7.5], 4 mM EDTA [pH 8.0],
GGTGG factor(s) are minimally required as DNA-binding 35 ,ug of tRNA per ml); the solution was extracted once with
proteins for function of LCR-like elements. It is likely that phenol-chloroform and precipitated with ethanol. The am-
the juxtaposition and interaction of these factors with each
Downloaded from http://mcb.asm.org/ on March 1, 2021 by guest
plification reaction products were resuspended in 100 pI of
other, and with accessory proteins not directly contacting water; 50 ,u was used in a three-cycle labeling reaction. The
DNA, account for the functional attributes of the regulatory labeling reaction was processed as described above and
elements of the globin LCRs. resuspended in 10 pI of formamide-dye; 1 to 2 pA was applied
to denaturing polyacrylamide gels. Gels were dried and
MATERIALS AND METHODS exposed to Kodak X-AR film with an intensifying screen at
Cell lines and cell culture. The interspecies human/mouse -70°C for 15 to 45 h.
somatic cell hybrid line J3-8B was established by the method Oligonucleotide primers. Oligonucleotides were synthe-
of Deisseroth and Hendrick (6) as modified by Zeitlin and sized on an Applied Biosystems DNA synthesizer model
Weatherall (38). Cells were cultured in Ham's F12 medium 380B and gel purified prior to use. For top- and bottom-
supplemented with 15% fetal calf serum; J3-8B cells contain- strand LMPCR genomic footprinting analysis, specific
ing human chromosome 16 were selected with methotrexate primer sets were used for the Sequenase extension reaction
(10 ,M), adenine (0.1 mM), and thymidine (30 ,M). HepG2 (primer 1), the PCR amplification reaction (primer 2), and the
cells were cultured in Dulbecco's modified Eagle's medium labeling reaction (primer 3). Primer sets for top-strand anal-
with 10% fetal calf serum. K562 cells (32) were cultured in ysis were as follows:
RPMI 1640 medium containing 10% fetal calf serum. S.1: 1, CTTCAGCTCCAGATGAAGAACG
Methylation and isolation of genomic DNA. J3-8B cells 2, AACGTATTTACTGTCTGGGTCAGGC
were induced by addition of 1.5% dimethyl sulfoxide 3, CTGTCTGGGTCAGGCTTTGCCCCTG
(DMSO) 48 h prior to in vivo methylation. In vivo methyla- S.2: 1, TCCAGAAGCAOTGAGTCATG
tion of cultured cells with DMS was done by the procedure 2, GAGTCATGGTTGGCCCAGTTATCTG
of Becker and Schutz (3). In vitro DMS methylation of 3, GGCCCAGTTATCTGCTCCCTCAAGTG
control protein-free DNA was performed according to Primer sets for bottom-strand analysis were as follows:
Maxam and Gilbert (18). In vivo-methylated and control AS.i: 1, AAGAGCTCCTTCTGCAACCAT
protein-free genomic DNAs were prepared by lysing cells in 2, CCATGATGACTGGGTCAAAGGACAG
harvest buffer (200 mM Tris-HCl [pH 7.5], 100 mM EDTA, 3, TGGGTCAAAGGACAGTGCAGGAGGCTC
1% sodium dodecyl sulfate, 0.2 mg of proteinase K per ml) AS.2: 1, CAACCATGACTCAGTGCTTC
for 3 to 4 h at 37°C. Sodium perchlorate was added to 1 M; 2, TTCTGGAGGCCAACAGGACTGCT
the mixture was extracted four times with phenol-chloro- 3, GGCCAACAGGACTGCTGAGTCATCCTG
form, precipitated with 2.5 volumes of ethanol, and resus- NF-E2 binding studies. NF-E2, purified from mouse eryth-
pended in 10 mM Tris-HCI (pH 7.5)-i mM EDTA-10 ,g of roleukemic (MEL) cells by affinity chromatography (la),
RNase A per ml; digestion of RNA was performed at 4°C for was used in gel shift assays (1) as follows. For each reaction,
15 to 20 h. The solution was extracted twice with phenol- a small aliquot (estimated 5 fmol) of purified NF-E2 was
chloroform, precipitated in 0.3 M sodium acetate with 2.5 incubated with 1 ng (2 x 104 dpm) of end-labeled 80-bp DNA
volumes of ethanol, and resuspended in 10 mM Tris-HCI (pH fragment containing the 46-bp NF-E2 binding site from
7.5)-i mM EDTA at a final concentration of 1 to 2 mg/ml. DNase-hypersensitive site 2 (HS 2) of the human P-LCR in
Base-specific DNA cleavage. The guanine/adenine-specific 10% glycerol-60 mM potassium chloride-20 mM N-2-hy-
cleavage of methylated DNA was modified from the G>A droxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-
chemistry described by Maxam and Gilbert (19). Specifi- KOH (pH 7.9)-6 mM magnesium chloride-1 mM dithiothre-
cally, water and 30 ,g of methylated genomic DNA were itol-0.2 mM EDTA-1 mg of bovine serum albumin per ml-50
combined to a volume of 100 ,u, an equal volume of 20 mM ,g of poly(dI-dC) per ml with or without 0.5 ,ug of nonra-
sodium phosphate (pH 7.0) was added, and the solution was dioactive oligonucleotide competitor per ml for 20 minutes at
mixed and incubated at 90°C for 15 min. The reaction room temperature. The samples were then electrophoresed
mixtures were collected by brief centrifugation and trans- at 17 V/cm through a 5% acrylamide (19:1 acrylamide/
ferred to ice; 20 ,u of 1 M sodium hydroxide was added, and bisacrylamide)-0.5 x Tris-borate-EDTA gel at room temper-
the solution was mixed well and incubated at 90°C for 30 ature for about 90 min. Oligonucleotide competitors (top
min. The reaction mixtures were collected again by brief strand) were as follows: porphobilinogen deaminase (PBGD)
centrifugation, neutralized with 1 M HCI, and precipitated in promoter, GATCCTGGGGAACCTGTGCTGAGTCACTG
0.3 M sodium acetate with 2.5 volumes of ethanol. Guanine/ GAGG; mutant 1 PBGD promoter, GATCCTGGGGAACC
adenine-specific cleavage products were resuspended in TGTTCTGAGTCACTGGAGG; mutant 2 PBGD promoter,
water at approximately 1 ,ug/ul. GATCCTGGGGAACCTGAGCTGAGTCAGTGGAG; andVOL. 12, 1992 IN VIVO FOOTPRINTING OF THE oa-GLOBIN LCR ELEMENT 2137
A & G ~A
G
B 2 G Fig. 1B, GA-cleavage chemistry reveals protection of two
adenines in J3-8B cells but not in either K562 or HepG2
G G
TT
cells. We draw two inferences from these data. First, GA-
_a
T~~~~~~~~~~
- _
cleavage chemistry provides information not obtainable with
l-
G chemistry alone. Second, K562 cells, though partially
AA
A
GATA 1 -A o
GATA
erythroid in phenotype, may be inadequate for the detection
T T
of in vivo footprints at many erythroid regulatory elements.
Of the multiple regions that displayed protein occupancy in
A
c c J3-8B cells, only a few corresponding sites showed detect-
G
A
G able, but less extensive, in vivo footprints in hemin-treated
FIG. 1. Analysis of in situ, DNA-protein interactions at the
K562 cells; no in vivo footprints were observed in uninduced
nonconsensus GATA-1 binding site in the ot-LCR element, using K562 cells. Presumably these differences are attributable to
guanine (A) and guanine/adenine (B) LMPCR in vivo footprinting. variability in expression and/or heterogeneity in the cellular
Expressing cell lines include in vivo-methylated J3-8B and K562; in commitment of our K562 cell line. The lack of an in vivo
vivo-methylated HepG2 cells were used as a nonexpressing control. footprint in HepG2 cells is most consistent with inaccessi-
Downloaded from http://mcb.asm.org/ on March 1, 2021 by guest
K562 cells were treated with 30 ,uM hemin for 2 days prior to in vivo bility of the ct-LCR element in nonerythroid (non-globin-
methylation; J3-8B cells were treated with DMSO as described in expressing) cells and the absence of GATA-1 protein in cells
Materials and Methods. The same preparations of methylated DNA of hepatic origin (35, 39).
were used for the two experiments. In vivo DMS footprinting of the human a-LCR element.
The major functional activity of the ox-LCR element has been
localized to a 350-bp region (15). We have examined this
o.1, TGGGCCAACCATGACTCAGTGCTTCTG; and a.2, region by GA-LMPCR in vivo footprinting. The analysis was
AACAGGACTGCTGAGTCATCCTGTGGG. performed in uninduced and DMSO-induced J3-8B cells.
Comparison was made with in vivo-methylated DNA from
HepG2 cells and with in vitro-methylated, protein-free
RESULTS DNA.
The human a-LCR element contains several motifs that
GA-LMPCR in vivo footprinting. In vivo footprinting has are bound by proteins present in nuclear extracts of eryth-
generally involved the use of DMS, an alkylating agent that roid and nonerythroid cells (15). These include four potential
penetrates the nucleus of intact cells to methylate genomic binding sites for the erythroid transcription factor GATA-1,
DNA at the N-7 position of guanines and the N-3 position two potential sites for AP-1 and/or the erythroid-factor
of adenines (3). Proteins bound at, or adjacent to, these designated NF-E2, and four potential sites for factors that
purine residues may either reduce (protect) or increase recognize CACC/GGTGG elements. Using DNase I foot-
(enhance) the frequency of DMS methylation in vivo in printing and gel shift analyses, Jarman et al. (15) have
comparison with protein-free, control DNA. Since adenines demonstrated in vitro interactions with many of these motifs
are methylated less efficiently than guanines (19) and the N-7 in the a-LCR element. GA-LMPCR in vivo footprinting of
position of guanines resides in the major groove of DNA, a the region is displayed in Fig. 2 to 4 and summarized in Fig.
common site for binding proteins, the reactivity of guanine 5. In nonerythroid HepG2 cells, no discernible footprint was
residues has been used exclusively for in vivo footprinting evident throughout the entire oa-LCR. In vivo footprints
studies of complex genomes. However, an analysis re- detected in J3-8B cells were unchanged following DMSO-
stricted to guanines is inherently limited in its informative- induced erythroid maturation with the single exception of an
ness. induced hypersensitivity in a region outside the previously
In vivo footprinting may also be limited by heterogeneity recognized binding motifs. Protein occupancy of each motif
in the cell population studied (25). Cell heterogeneity with is described below.
regard to level of gene expression, stage of differentiation, or GATA elements. Sequences of the general form (T/A)GA
cell type may compromise or obscure observable in vivo TA(A/G) (11) bind the abundant, erythroid transcription
protein-DNA interactions. factor GATA-1 (10, 35). Of four potential GATA-1 binding
Two aspects of our experiments were critical to a com- sites in the ao-LCR element, including a nonconsensus site
plete in vivo footprinting analysis of the human a-globin (TGA1T7A), only three display protections or enhancements
regulatory element. First, we modified DNA cleavage con- in vivo in J3-8B cells (Fig. 2, 4, and 5). The upstream GATA
ditions to permit scoring of adenine as well as guanine site identified by in vitro binding studies (15) is not contacted
residue contacts (GA-LMPCR in vivo footprinting). Second, in vivo.
we compared footprints of the same chromatin region in AP-1/NF-E2 elements. Two AP-1 consensus sites [TGA(C/
different cellular environments. In this regard, we examined G)TCA] reside in the central portion of the a-LCR element.
the human chromosome 16 a-LCR element in K562 cells, Motifs of this variety are bound by a multiplicity of proteins
which exhibit erythroid, megakaryocytic, and myeloid prop- in vitro, including an erythroid-restricted factor (NF-E2).
erties (17, 32), in MEL cells containing a single human This factor, which was first identified through study of the
chromosome 16 (line J3-8B), and in nonerythroid hepatoma erythroid promoter of the PBGD gene (20, 21), appears to
(HepG2) cells. mediate enhancer activity of a segment of human P-LCR HS
As shown by the example in Fig. 1, the combined use of 2 encompassing an AP-1 dimer motif (22, 26, 27, 33).
GA-cleavage chemistry and MEL hybrid cells greatly en- GA-LMPCR in vivo footprinting reveals strong protections
hances the power of this technique at elements in which G and enhancements over both AP-1/NF-E2 motifs in the
residues are not contacted. With G chemistry alone, no in oa-LCR element (Fig. 2, 4, and 5). Jarman et al. (15) observed
vivo footprint is detected in either J3-8B hybrid or noneryth- in vitro footprints in this region in both erythroid and
roid HepG2 cells in the vicinity of a potential GATA motif in nonerythroid cells. Although they identified an erythroid-
the human oa-LCR element (Fig. 1A). However, as shown in specific gel shift complex corresponding to NF-E2 with use2138 STRAUSS ET AL.
I
!.
