A Stem Cell-Specific Silencer in the Primer-Binding Site of a Retrovirus
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, Mar. 1991, p. 1214-1221 Vol. 11, No. 3
0270-7306/91/031214-08$02.00/0
Copyright 0 1991, American Society for Microbiology
A Stem Cell-Specific Silencer in the Primer-Binding
Site of a Retrovirus
RICHARD PETERSEN, GERALDINE kEMPLER, AND ERIC BARKLIS*
Vollum Institute for Advanced Biomedical Research and Department of Microbiology and Immunology,
Oregon Health Sciences University, Portland, Oregon 97201
Received 13 September 1990/Accepted 29 November 1990
Retrovirus expression in embryonal carcinoma (EC) cells is blocked at a postintegration stage of the viral life
cycle, in part because of the inadequate function of the viral long terminal repeat promoter in this cell type.
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
However, selection for retrovirus expression in EC cells has identified mutations in Moloney murine leukemia
virus (M-MuLV) located in the tRNA primer-binding site (PBS) region which relieve the EC cell-specific
repression. We have found that exchanging the M-MuLV proline PBS for a glutamine one in a recombinant
virus permits expression in EC cells. By using the recombinant virus as a backbone, the EC cell-specific
repressor-binding site (RBS) element has been mapped to M-MuLV nucleotides 147 to 174. The RBS does not
require precise positioning downstream of the M-MuLV promoter and can function in either orientation and
in an intron, indicating that the regulatory effect is probably at the DNA, rather than RNA, level. We also show
that the RBS element can repress heterologous promoters from an upstream position. Our results indicate that
the RBS acts as a silencer that its inhibitory effect is mediated by a trans-acting factor, and that the mechanism
of action is probably at the level of transcription. Through in vitro binding assays we have identified a binding
factor which specifically recognizes the wild-type RBS sequence (binding factor A). The binding characteristics
of factor A suggest that it is a stem cell repressor which acts at the M-MuLV RBS. Our DNA-binding assays
also have identified a unique binding factor (binding factor Hp) which specifically recognizes a hemimethylated
form of the wild-type RBS. This factor may play a role in methylation mediated control of retrovirus expres-
sion in EC cells.
Embryonal carcinoma (EC) cells derive from spontaneous elements (11), one in the LTR U3 region (13) and one in the
gonadal tumors or from tumors induced by ectopic place- vicinity of the primer-binding site (PBS) (5, 21, 22). These
ment of preimplantation embryos and are the earliest cultur- elements inhibit virus expression specifically in undifferen-
able stem cells in mammalian organisms (6, 34). Spontane- tiated cells. The PBS region, which binds a cellular tRNA to
ous lines develop from malignant stem cells present in primer first-strand synthesis during reverse transcription,
teratocarcinomas and display morphological, biochemical, appears to have a second function in mediating stem cell
and biological properties of pluripotent cells of the early transcriptional repression. Loh et al. (22) have shown that
embryo (6, 10). A number of differentiated cell functions are the PBS-mediated EC cell-specific repression can be com-
repressed in EC cells. The inactivity of a variety of promot- pletely outcompeted in DNA transfection experiments. Mu-
ers in undifferentiated EC cells demonstrates that, at least tations in the PBS region have been shown to relieve
partially, this regulation occurs at the level of transcription, repression in transfections as well as infections (5, 38), again
although it is clear that inactive transcriptional units ulti- indicating that the effect is not at the level of viral integra-
mately become repressed by DNA methylation (28, 35). tion. These results suggest that the tRNA PBS function
One characteristic common to EC cells and preimplanta- during reverse transcription and the repressor-binding site
tion embryos is that they are nonpermissive for the expres- (RBS) function, which inhibits viral expression specifically
sion of viral genomes, including the Moloney murine leuke- in EC cells, are independent phenomena mediated by the
mia virus (M-MuLV) genome (15, 28, 35, 36). Retroviral same or partially overlapping sequences.
integration is unimpaired in EC cells, but viral RNA accu- To date, the smallest sequence change to abolish the RBS
mulation is blocked (12, 35). The restriction of retrovirus effect is the B2 mutation (5), a single-base-pair change (G to
expression in undifferentiated EC cells appears to be primar- A) at M-MuLV nucleotide (nt) 160. However, owing to the
ily at the level of transcription (12, 20), although posttran- mechanism of retroviral replication, the B2 mutation reverts
scriptional mechanisms have also been proposed (35). The at high frequency and cannot be used to map the RBS region
promoter in the retroviral long terminal repeat (LTR) func- in infection assays. To circumvent this problem, we have
tions inadequately in EC cells and is at least partly respon- generated a recombinant retrovirus, PBS-glutamine (PBSQ).
sible for the low level of virus-specific RNA detected (13, In PBSQ, the wild-type (wt) M-MuLV proline PBS has been
20). It is not clear whether the enhancer is inactive because exchanged for a homologous glutamine PBS from an endog-
of the presence of an enhancer-specific repressor, the ab- enous provirus (7). Because PBSQ contains five single-base-
sence of specific enhancer-binding factors in EC cells, or pair changes from the wt M-MuLV sequence (including the
both. B2 G-to-A mutation) and is entirely homologous to a murine
In addition to the enhancer element, the M-MuLV provi- tRNAGln, it is expressed in EC cells and does not revert at
rus contains at least two cis-acting negative regulatory high frequency. We have used M-MuLV retroviral con-
structs containing PBSQ to test the effect of wt and mutant
repressor fragments on viral expression in transfections and
*
Corresponding author. infections of EC cells. Our results substantiate the view that
1214VOL. 11, 1991 STEM CELL-SPECIFIC SILENCER 1215
the inhibitory effect of this cis-acting element is due to the Thornell et al. (37). Specific double-stranded competitors
binding of a trans-acting regulatory factor to the RBS, which were prepared by annealing single-stranded oligonucleotides
probably limits viral expression by blocking transcription. as described by Speck and Baltimore (33). Probes were made
by kinase labeling of single-stranded oligonucleotides, an-
MATERIALS AND METHODS nealing to the complementary strand, and gel purification of
double-stranded forms (33, 37).
Recombinant plasmids and DNA methodology. Unless oth- Methylated probes were prepared by incubating more than
erwise noted, all cloning methods used were essentially as 106 cpm (approximately 10 ng) of wt 28-bp probe in 10 to 20
described by Maniatis et al. (24). All M-MuLV designations U of bacterial HpaII or MspI methylase overnight at 37°C (as
refer to the M-MuLV genomic RNA as described by Shin- described in the technical data from New England Biolabs).
nick et al. (32). MP10 is a 4,670-bp provirus or a 9,200-bp The wt 28-bp RBS of M-MuLV contains a 5'-CCGG-3'
plasmid and has been described by Barklis et al. (5). PBSQ sequence which is methylated by these two methylases;
is identical to MP10 except that the PBS sequences have HpaII methylase attaches a methyl group to the internal C,
been exchanged for homologous sequences from an endog- whereas MspI methylase attaches a methyl group to the
enous mouse retrovirus originally isolated by Colicelli and external C. Following phenol-chloroform purification and
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
Goff (7). The substitution of sequences from M-MuLV nt 32 ethanol precipitation, the quality of methylation was
to 212 changes to tRNA PBS from PBS-proline in MP10 to checked by restriction digest with methylation-sensitive
PBS-glutamine in PBSQ. The various PBSQ constructs restriction enzymes and analyzed by electrophoresis on 10%
contain either the 47-bp (M-MuLV nt 139 to 185) or the 28-bp native acrylamide gels. The hemimethylated forms of the wt
(M-MuLV nt 147 to 174) wt or B2 mutant (single-base-pair probes were prepared from the completely methylated
G-to-A mutations at M-MuLV nt 160) (5) PBS sequences forms. Following denaturation by heating, a 10-fold molar
inserted into the unique BamHI site of PBSQ after being excess of the single-stranded oligonucleotide complemen-
subcloned into identical Bluescript vectors (Stratagene). tary to the strand which was labeled in the preparation of the
LJ-P and LJ-Q are similar to the previously described vector original probe was added to the mixture and allowed to
DOL (18), except that portions of the 5' LTRs through the anneal by incubation at 50°C for 30 min, followed by a
BamHI site derive from MP10 and PBSQ, respectively. 30-min incubation at room temperature. The resulting
LJ-PEnh- and LJ-QEnh- are variants of LJ-P and LJ-Q probes, with one strand end labeled with _y32P and methyl-
with 3' LTR enhancer deletions (8) corresponding to ated at the described nucleotide, and the other strand neither
M-MuLV nt 7938 to 8114. LJ-PAdMLPEnh- and LJ-QAd labeled nor methylated, were gel purified.
MLPEnh- are identical to LJ-PEnh- and LJ-QEnh-, except
that they use the adenovirus major late promoter (AdMLP, RESULTS
nt -248 to +34) as their internal promoter.
Cell culture and RNA analysis. EC cell lines F9 and PCC4 EC cell restriction maps to an RBS at M-MuLV nt 147 to
(6), NIH 3T3 fibroblasts, and Psi2 (25) and PA317 (27) 174. To analyze the mechanism by which retrovirus mutants
packaging cell lines were grown as described previously (5). permit EC cell expression, we have constructed a M-MuLV
Psi2 packaging cell populations expressing most proviruses recombinant, PBSQ. PBSQ is similar to its wt parent, MP10,
were generated by the transfection-infection protocol de- in that its neomycin (neo) gene is expressed from the
scribed by Jones et al. (17), and G418 selections were as M-MuLV LTR promoter and is positioned downstream from
described previously (5). Transfections were performed by a small intron which contains a unique BamHI cloning site
the procedure of Graham and Van der Eb (14) as modified by (Fig. 1). However, PBSQ differs from MP10 in that wt
Parker and Stark (29), and direct-transfection protocols were M-MuLV nt 32 to 212 have been exchanged for homologous
used for generation of Psi2 populations expressing enhancer sequences from an endogenous mouse retrovirus (7). This
deletion constructs. Virus infection and titering, as well as switch of 5 bp changes the PBSQ PBS from proline to
RNA isolation, blotting, and hybridizations, were performed glutamine and includes the B2 G-to-A host range mutation
as described previously (4, 5, 38). (5). PBSQ and MP10 are expressed very differently in EC
Protein extracts and gel shift assays. Nuclear extracts were cells relative to differentiated cells such as NIH 3T3 fibro-
prepared from tissue culture cells essentially as described by blasts (Table 1). With MP10, the EC cell restriction index,
Dignam et al. (9) with the modifications of Baeuerle and defined as the ratio of NIH 3T3 to EC cell titers, is greater
Baltimore (2, 3), which permit the fractionation of nuclear, than 2,000, indicating a high level of restriction. In contrast,
cytosolic, and postnuclear protein extracts. All extracts PBSQ demonstrates a 50- to 100-fold-lower ratio, indicating
were dialyzed against Dignam buffer D (20 mM N-2-hydroxy- that repression has been alleviated. It should be noted that
ethylpiperazine-N'-2-ethanesulfonic acid [HEPES; pH 7.9], we have included the results from two different PBSQ viral
100 mM KCl, 20% [vol/vol] glycerol, 0.2 mM EDTA, 0.5 mM supernatants to reconfirm our previous results (5, 38) that
phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol). The absolute titers (as defined by NIH 3T3 titers) may vary as a
preparation of radioactive probes and the gel shift procedure result of factors such as the time of supernatant collection
were essentially those of Thornell et al. (37), with the and density of virus-producing cells, but the EC restriction
following exceptions. The binding reactions were carried out index is relatively invariant. An additional point is that
in a total reaction volume of 20 ,ul containing 5 mM NaCl and despite its relatively high level of expression in EC cells,
15 to 20 mM KCl in addition to the standard Thornell binding PBSQ expression is reduced in this cell type relative to NIH
buffer (25 mM HEPES [pH 7.9], 1 mM EDTA, 10% [vol/vol] 3T3 cells. We assume that this reduction reflects the fact that
glycerol, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl in addition to possessing a transcriptional repressor, stem
fluoride), 20,000 cpm of probe (approximately 0.2 ng), and cells lack positive-acting factors necessary for full activity of
100 ng of poly(dI-dC), with a final protein concentration of the M-MuLV LTR promoter (20).
approximately 250 ,ug/ml. Binding reactions were incubated With the parental vector PBSQ, we have found it possible
for 15 to 30 min at room temperature. The electrophoresis to distinguish the M-MuLV leader sequence PBS function
system used was the Tris-glycine system as described by from its stem cell RBS function. To map the RBS sequences1216 PETERSEN ET AL. MOL. CELL. BIOL.
1000 bp
LTR sd s NEO LTR BamH Hindil
MP1O I-1 I II I L-P
Bamrn LTR SV40 NEO LTR
BamH HidiI
PBSQ I X Ii l m LJ-
LTR SV40 NEO LTR
BamH H tdll
IQiw71
1 I 1 LJ-PEnh-
LTR
LTR SV40 NEO
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
PBSO-wt47+ PBSO-wt28+ BamHi Hidil
PBSO-wt47- 4- *- PBSQ-wt28- LJ-QEnh-
LTR SV40 NEO LTR
PBSQ-m47+ * _.o.. PBSQ-m28+ BamH Hrmdll
PBSO-m47- 4 +4E~ PBSQ-m28- LJ-PAdMLPEnh-
LTR AMUL NEO LTR
WT28+: 5' GGGGGCTCGTCCGGGATCGGGAGACCCC 3
M28+ :5'7GG7CT1 TcCGGATCGOAGACCCC 3' BamI Hfidil
LJ-QAdMLPEnh-
LTR AdMLP NEO LTR
FIG. 1. Recombinant viral constructs. The previously described (5) MP10 retroviral vector expresses the neomycin (neo) gene from the
M-MuLV LTR promoter. The neo gene in this vector is positioned downstream from a small intron (indicated by sd [splice donor] and sa
[splice acceptor] which contains a unique BamHI cloning site. PBSQ is identical to MP10, except that RBS region sequences have been
exchanged for homologous sequences from an endogenous mouse retrovirus (7), indicated in black on the PBSQ map. Substitution of
sequences from M-MuLV nt 32 to 212 changes the tRNA PBS from PBS-proline to PBS-glutamine (PBSQ). PBSQ-wt47+, PBSQ-wt47-,
PBSQ-wt28+, PBSQ-wt28-, PBSQ-m47+, PBSQ-m47-, PBSQ-m28+, and PBSQ-m28- all derive from PBSQ but contain wt or mutant m RBS
fragments in either the sense (+) or antisense (-) orientation cloned into the PBSQ BamHI site. The wt 47-bp fragment contains M-MuLV
DNA from nt 139 to 185; the wt 28-mer contains M-MuLV DNA from nt 147 to 174. Mutant 47- and 28-bp fragments are identical to the wt
fragments except that they contain the G-to-A mutation (originally called B2 [5]) at nt 160. Sense strands of wt and mutant 28-bp fragments
are as shown. LJ-P and LJ-Q are identical to the previously described vector DOL (18), except that portions from the 5' LTRs through the
BamHI sites derive from MP10 and PBSQ, respectively. In these vectors, the neo genes are located immediately downstream from the
internal SV40 promoters (SV40 nt 208 to 5107) ( El ) LJ-PEnh- and LJ-QEnh- are variants of LJ-P and LJ-Q with 3' enhancer deletions
(M-MuLV nt 7938 to 8114), which self-inactivate 5' and 3' LTR promoters on viral replication and proviral insertion (8) so that neo
transcription is predominantly or completely from the internal SV40 promoters. LJ-PAdMLPEnh- and LJ-QAdMLPEnh- are identical to
LJ-PEnh- ad LJ-QEnh- except that they use the AdMLP (nt -248 to +34) (11111) as their internal promoter.
responsible for EC cell repression, we constructed various activity is independent of viral proteins has been shown by
PBSQ vectors which contain either 47-bp (M-MuLV nt 139 repression in direct transfections of EC cells with MP10
to 185) or 28-bp (M-MuLV nt 147 to 174) inserts, derived versus the B2 mutant (5) and with the constructs (Fig. 1)
from either the wt or B2 mutant RBS regions, at the unique PBSQ-wt28- versus PBSQ-m28- (data not shown).
BamHI site. neo titers, expressed as G418-resistant CFU per RBS repression of heterologous promoters. To further
milliliter of viral supernatant, indicate the level of expression characterize the EC cell restriction properties of the
of these retroviral constructs in EC and NIH 3T3 cells (Table M-MuLV RBS, we studied the effects of wt and PBSQ RBS
1). The EC cell restriction (NIH 3T3 to EC titer) for each of sequences on the simian virus 40 (SV40) early promoter and
the constructs shows that the wt 47- and 28-bp sequences adenovirus major late promoter (AdMLP). In these experi-
restrict expression in EC cells when inserted in either ments, viral vectors expressing the neo gene from the
orientation into the BamHI site of PBSQ, as indicated by internal SV40 early promoter or AdMLP, with either wt or
ratios of greater than 3,500. However, the ratio of NIH 3T3 PBSQ RBS sequences in an upstream position, were com-
to EC titers observed for the PBSQ constructs containing the pared (Fig. 1; Table 1). The LJ constructs, LJ-P and LJ-Q,
mutant 47- and 28-bp inserts were 50- to 100-fold lower. are derived from the DOL vector described by Korman et al.
Thus, the difference in EC cell restriction between PBSQ wt (18). The neo gene is driven by the SV40 early promoter in
and mutant insert constructs is similar to the difference these constructs, and they are identical except that LJ-P has
between MP10 and PBSQ itself. a wt RBS region whereas LJ-Q has a PBSQ-like RBS region.
These results allow us to define a stem cell cis-acting RBS The high NIH 3T3/EC ratio observed for LJ-P (Table 1; NIH
element which maps to M-MuLV nt 147 to 174. EC cell 3T3/EC ratio, 6,651) indicates that the wt RBS sequence
repression occurs when the RBS is inserted in either orien- repressed neo expression from the SV40 promoter in EC
tation and in an intron downstream of the M-MuLV LTR cells relative to NIH 3T3 cells, when in an upstream posi-
promoter, suggesting that the repression occurs at the DNA, tion. The PBSQ variant, LJ-Q, showed a relatively low NIH
rather than the RNA, level. The position of the RBS down- 3T3/EC ratio (Table 1; NIH 3T3/EC ratio, 80), indicating that
stream of the viral LTR promoter in our constructs indicates its RBS region did not mediate repression of the SV40 early
that this activity can work at a distance. That this repressor promoter.VOL . 1 l, 1991 STEM CELL-SPECIFIC SILENCER 1217
TABLE 1. Viral titers A B C D E F
Neomycin titers' in: Ratio of NIH
Construct'
NIH 3T3 cells EC cells T/Cttr
3T3/EC titers MuLV -*
MP1O 22,000 10 2,200 SV40 -b
PBSQ (expt 1) 12,000 660 18
PBSQ (expt 2) 550,000 15,000 37 s: WI -
FIG. 2. neo transcripts from M-MuLV and SV40 promoters in
PBSQ-wt47+ 625,000 80 7,812 infected cells. Total cellular RNA from infected G418-resistant NIH
PBSQ-wt47- 375,000 100 3,750 3T3 (lanes A to D) or EC (F9) (lanes E and F) cells was fractionated
PBSQ-m47+ 175,000 2,000 88 by denaturing agarose gel electrophoresis and blotted onto nitrocel-
PBSQ-m47- 250,000 20,000 13 lulose as described in Materials and Methods. Proviral neomycin
PBSQ-wt28+ 68,000 3 22,667 (neo) transcripts were detected by autoradiography after hybridiza-
PBSQ-wt28- 52,000 4 13,000 tion with a radiolabeled neo probe. Lanes: A, 7 ,ug of RNA from
PBSQ-m28+ 80,000 321 249 NIH 3T3 cells infected with LJ-P; B, 8.5 jig of RNA from NIH 3T3
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
PBSQ-m28- 82,000 675 121 cells infected with LJ-Q; C, 10.5 ,ug of RNA from NIH 3T3 cells
infected with LJ-PEnh-; D, 14.0 ,ug of RNA from NIH 3T3 cells
LJ-P 286,000 43 6,651 infected with LJ-QEnh-; E, 14.0 ,ug of RNA from EC cells infected
LJ-Q 272,000 3,400 80 with LJ-Q; F, 26 jig of RNA from EC cells infected with LJ-QEnh-.
LJ-PEnh- 62,500 220 284 Constructs are as described in the legend to Fig. 1. Transcripts
LJ-QEnh- 50,000 2,650 19 initiated by M-MuLV LTR and SV40 early promoters are as indi-
LJ-PAdMLPEnh- 7,800 20 390 cated. Note that no neo signal is detected with RNA from uninfected
LJ-QAdMLPEnh- 18,500 2,050 9 NIH 3T3 or EC cells (data not shown). All lanes were fractionated on
the same gel and hybridized on the same filter, but lanes E and F
a
Constructs are as described in the legend to Fig. 1. represent threefold-longer exposures than lanes A to D.
b Titers in NIH 3T3 and EC cells for a given viral supernatant were
determined at the same time. neo titers are expressed as G418-resistant CFU
per milliliter of viral supernatant. For this table, the EC cells used were F9
cells, although similar results have been obtained with PCC4 cells. The ratio
of NIH 3T3 to EC titers is given as an indicator of the EC cell restriction of cells possess at least five factors which bind to the wt 28-bp
a particular viral construct: higher values are indicative of greater restriction RBS probe (Fig. 3, lane 2, bands A, B, C, D, and E versus
in EC cells. Note that results with two different PBSQ viral supernatants are the free probe, band F). Of these bands, only band A appears
shown to indicate that absolute titers (as defined by NIH 3T3 titers) may vary to be specific for the wt RBS probe and is absent when the
as a result of factors such as time of supematant collection or density of
virus-producing cells, but the EC restriction value (NIH 3T3/EC) is relatively mutant probe is used. The cellular factor responsible for
invariant (18 versus 37). band shift A was also present in cytoplasmic fractions of
PCC4 cells (lane 6 [wt] versus lane 15 [mutant]), as well as
nuclear and cytoplasmic fractions of extracts from undiffer-
entiated F9 EC cells (data not shown).
It could be argued that LJ-P and LJ-Q expression levels To examine the specificity of binding for factor A, we
are influenced by their wt M-MuLV LTR promoters. To performed competition experiments by using unlabeled com-
address this concern, we performed additional experiments petitor fragments in our DNA-binding reactions (Fig. 3 and
with the M-MuLV enhancer-deleted constructs LJ-PEnh- 4). The addition of 4 ng or more of unlabeled double-
and LJ-QEnh- (Fig. 1). These enhancer deletions signifi- stranded wt fragment effectively competed for the binding of
cantly reduced the level of M-MuLV LTR-driven transcripts factor A (Fig. 3, lanes 5 and 9; Fig. 4, lanes 2 and 8), whereas
in NIH 3T3 cells (Fig. 2, lanes C and D versus A and B) and the addition of unlabeled double-stranded mutant fragment
eliminated the already low levels of LTR-driven transcripts did not compete for this binding (Fig. 4, lanes 3 and 9). The
in EC cells (lane F versus lane E). When LJ-PEnh- and addition of several different unlabeled single-stranded com-
LJ-QEnh- were assayed and the NIH 3T3/EC ratios were petitor DNAs (ssDNA) to the binding reactions did not
analyzed, we still observed a 15-fold difference in EC cell interfere with factor A binding (Fig. 3, lanes 3, 4, 7, and 8;
restriction between the two. The AdMLP constructs, U- Fig. 4, lanes 4 to 6 and 10 to 12). As a control, it is clear that
PAdMLPEnh- (Table 1; NIH 3T3/EC ratio, 390) and U- ssDNA did compete for binding of other factors in Fig. 3 and
QAdMLPEnh- (Table 1; NIH 3T3/EC ratio, 9), showed a 4 (see bands B and C).
similar RBS effect. The EC cell repression observed for Methylation and hemimethylation studies. Factor A binding
these constructs was more than 40-fold greater in the wt is very sensitive to changes in a variety of binding condi-
construct than in the PBSQ construct. These findings sug- tions. Because of this, we have not found it possible to
gest that the inhibitory effect on the M-MuLV LTR promoter isolate enough factor A complex to perform convincing
attributed to the RBS, when in a downstream position, can DNase I protection or standard methylation interference
be expanded to include the heterologous SV40 early pro- assays, even when the reaction volumes were increased 5- to
moter and AdMLP when in an upstream position. 20-fold. To circumvent this problem, we are attempting the
Specific binding of a cellular factor to the M-MuLV RBS. partial purification of factor A for eventual use in such
The results described above suggest that RBS-mediated studies. However, we also have identified specific binding
repression occurs at the DNA level and that undifferentiated contacts by use of bacterial methylases. In these experi-
EC cells possess a trans-acting DNA-binding factor which ments we methylated our wt 28-bp RBS probe in vitro with
binds to the M-MuLV RBS to repress gene expression. To dam, HpaII, and MspI methylases. Factor A binding was
identify such a factor, we have used the gel electrophoresis not affected by dam methylation of the A residues in GATC
DNA-binding assay (band shift or gel retardation assay [33, sequences on both strands of the wt 28-bp probe (data not
37]) with our wt and single-base-pair (B2) mutant 28-bp RBS shown). In contrast, factor A binding was abolished when
sequences as probes. the wt probe was methylated at the internal or external
Nuclear extracts prepared from undifferentiated PCC4 cytosines of the sequence CCGG by HpaII and MspI meth-1218 PETERSEN ET AL. MOL. CELL. BIOL.
2_ 3 4 5 61 9 1 1½
' 41t5 2 3 4 '"b .8 9 1011 'd
w"t
.4$vkwt ~~~~~~~~~~~~~~~~~~~~~~~~~i
.lwimw
A8- ip 4 %
Be+ im c~~~i .W
W~~&A
-0 . -AliNk..,: -w-Aw
.11%, AV
CM+ .:, W*
-
v 4...
Dm4 *"* .0
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
k 0 'm '.
.,O
En+ s Z.:
i. i,
.? r
Y,
.i'
.
,:
,. I
F-I
FIG. 3. M-MuLV RBS binding factors. The double-stranded (ds)
wt or mutant (m) 28-bp probes below were labeled and isolated as
described in Materials and Methods. FIG. 4. Binding-factor competition studies. Wt probe, prepared
as described in the legend to Fig. 3, was incubated under standard
wt5'GGGGG CTCGT CCGGG ATCGG GAGCA CCC3' conditions with 50 ,ug of PCC4EC cell extract per ml. In lanes 2 to
3' CCCCC GAGCA GGCCC TAGCC CTCGT GGG 5' 6, 4 ng of unlabeled competitor DNA was added; in lanes 8 to 12, 10
m 5' GGGGG CTCGT CCGaG ATCGG GAGCA CCC 3' ng of competitor DNA was added. Competitor DNAs were as
3' CCCCC GAGCA GGCtC TAGCC CTCGT GGG5' follows: wt dsDNA probe, lanes 2 and 8; mutant dsDNA, lanes 3
and 9; wt sense strand ssDNA, lanes 4 and 10; wt antisense strand
We used 20,000 cpm of wt (lanes 1 to 9) or mutant (lanes 10 to 15) ssDNA, lanes 5 and 11; M13 ssDNA, lanes 6 and 12. Bands A and
probe in each binding assay. The probes were incubated in 20 ,ul C correspond to bands A and C in Fig. 3. Free probe is indicated (F)
reactions with no extract (lanes 1 and 10), with 50 ,ug of PCC4 EC at the bottom of the gel.
cell nuclear extract per ml (lanes 2 to 5 and 11 to 14) or with 250 ,ug
of PCC4EC cell cytoplasmic extract per ml (lanes 6 to 9 and 15). In
the following lanes, 4 ng of unlabeled competitor DNA was added:
M13 ssDNA, lanes 3, 7, and 12; ssDNA wt probe, lanes 4, 8, and 13; To identify specific nucleotides involved in binding, we
dsDNA wt probe, lanes 5, 9, and 14. Incubations of 15 min at 25°C also performed band shift assays with hemimethylated forms
were performed by using standard binding conditions (37) plus 100 of the wt probe. For these experiments, labeled wt probes
ng of dI-dC, 5 mM KCI, and 5 mM NaCl. Reactions were terminated were methylated; denatured; renatured with an excess of
by addition of loading dye, and free and complexed probes were unmethylated, unlabeled complementary strand; and reiso-
separated by electrophoresis on a 6% acrylamide-Tris-glycine gel. lated. Factor A binding was unaffected when the sense
Bands visualized after autoradiography with intensifying screes are
complexes A, B, C, D, and E, as well as free probe, F. Band A is strand was methylated with HpaII (Fig. 5, lane 10) or MspI
specifically detected with the wt but not the mutant probe. Similar (lane 11) methylases, but was drastically diminished when
results are obtained when probes are labeled on the opposite strand. the antisense strand was methylated with HpaII (lane 12) or
Note that band B is variable in our hands and is not detected in all MspI (lane 13) methylases. (Note that the reduction of factor
gels. A complex with hemimethylated probes in lanes 12 and 13
was comparable to the effect of total methylation in lanes 4,
5, 7, and 8.) Surprisingly, formation of the factor Hp
ylases, respectively (Fig. 5, lanes 4 and 7 [HpaII] and 5 and complex, which requires CpG methylation (lanes 4 and 7),
8 [MspI] versus lanes 2 and 3 [unmethylated] and 6 and 9 was dependent on methylation on the wt probe sense strand
[mock methylated]). Interestingly, although methylation in- (lane 10) and did not occur when only the antisense CpG was
terfered with factor A binding, we also observed a new cytosine methylated (lane 12). Thus, both Hp and A factors
DNA-binding factor (designated Hp) that is detected with bind to the sense strand hemimethylated probes, but neither
the HpaII methylated probe (Fig. 5, lanes 4 and 7). bind probe which is antisense hemimethylated. To verifyVOL . 1 l, 1991 STEM CELL-SPECIFIC SILENCER 1219
(20). Also, at least two cis-acting negative regulatory ele-
ments participate in the EC repression phenomena, one of
which is in the vicinity of the primer-binding site (5, 11, 13,
21, 22, 38).
Some retroviral integrants are able to circumvent the EC
cell restriction by inserting downstream of strong cellular
promoters (5, 30), whereas others do so by mutation of one
of the cis-acting negative regulatory domains (5, 38). Our
evidence, and the evidence of others (21, 22), suggests that
H p the M-MuLV RBS element mediates stem cell viral restric-
tion by binding to an EC cell-specific trans-acting factor
which interferes with expression. PBSQ, a recombinant
retroviral construct containing mutations in the RBS region,
is expressed at 100-fold-higher levels in undifferentiated EC
cells than in wt M-MuLV constructs such as MP10, indicat-
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
ing that repression is not simply a consequence of perfect
PBS matching to a cellular tRNA. We have inserted wt and
B2 host range mutant RBS sequences downstream of the
M WT Hp 'Ms 'VWT HP' Ms's WTfHp-' Ms' Hp'- Ms'-
viral LTR promoter in recombinant PBSQ constructs. Our
results indicate that this 28-bp sequence can mediate repres-
FIG. 5. Factor binding to methylated and hemimethylated sion from the LTR promoter when placed in an intron in
probes. Probes were labeled as described in Materials and Methods either orientation (Fig. 1; Table 1).
and incubated, as legend to Fig. 3, with 175 p.g of
described in the To analyze the effect of the RBS on heterologous promot-
PCC4 extract per ml prior to electrophoretic separation. Probes ers, we placed our wt and mutant RBS elements upstream of
were as follows: lane 1, mutant probe; lane 2, wt sense strand the SV40 early promoter or the AdMLP driving neo expres-
labeled; lane 3, wt antisense strand labeled; lane 4, wt fully HpaII sion. In the constructs LJ-P, LJ-PEnh-, and LJ-PAdML
methylated, sense strand labeled; lane 5, wt fully Mspl methylated,
sense strand labeled; lane 6, wt mock methylated, sense strand
PEnh- (Fig. 1), the wt M-MuLV RBS sequence repressed
labeled; lane 7, wt fully Hpall methylated, antisense strand labeled;
EC cell expression from the SV40 early promoter and
lane 8, wt fully MspI methylated, antisense strand labeled; lane 9, wt
AdMLP (Table 1). In contrast, the variant RBS in LJ-Q,
mock methylated, antisense strand labeled; lanes 10 to 13, wt probes LJ-QEnh-, and LJ-QAdMLPEnh- did not repress expres-
labeled on the sense (lanes 10 and 11) or antisense (lanes 12 and 13) sion in EC cells. The enhancer-deleted constructs showed
strands and hemimethylated on the lowercase nucleotide as shown little or no neo expression from the viral LTR promoter as
below: assayed by Northern (RNA) blot analysis (Fig. 2). There-
lane 10, sense strand Hpall hemimethylated: fore, we can conclude that the RBS effect observed for these
5' GGGGG CTCGT CcGGG ATCGG GAGAC CCC 3'
constructs is on the SV40 early promoter and the AdMLP.
3' CCCCC GAGCA GGCCC TAGCC CTCTG GGG 5' Because we (5) and others (21) have observed RBS-
mediated EC cell-specific restriction of gene expression in
lanell, sense strand Mspl hemimethylated: transfections and have shown that such repression involves
5' GGGGG CTCGT cCGGG ATCGG
TAGCCO
GAGAC
CTCTG
CCC 3'
GGG 5'
the regulation of RNA levels (22, 38), our evidence suggests
3' CCCCC GAGCA GGCCC
that repression is mediated by an EC cell-specific regulatory
lane 12, antisense strand Hpall hemimethylated: factor which binds to the RBS at the DNA level. Our band
5' GGGGG CTCGT CCGGG ATCGG GAGAC CCCY3 shift studies have identified a DNA-binding factor, factor A,
3' CCCCC GACCA GGcCC TAGCC CTCTG GGG 5' which specifically binds to the wt RBS sequence and not to
lane 13, antisense strand MspI hemimethylated:
the single-base-pair mutant sequence (Fig. 3 to 5). Loh et al.
5' GGGGG CTCGT CCGGG ATCGG GAGAC CCCY3 (23) also have reported the identification, by exonuclease III
3'COCCOC GAGCA GGCcC TAGCCO CTCTG GGG 5' protection analysis, of a factor which specifically binds to
the wt RBS sequence. The extreme sensitivity of factor A
Methylation was checked as described in Materials and Methods.
has precluded ready complex isolation for standard DNase I
Band A indicates binding factor A, and Hp designates the factor
which binds to the HpaII methylated wt probe. Only a portion of the
protection and methylation interference assays: it is hoped
gel is shown.
that partial purification of the factor will facilitate such
studies. Nevertheless, our analyses with methylated probes
(Fig. 5) indicate several contact sites of factor A with the wt
RBS. dam methylation at adenine nucleotides (M-MuLV
this, we possibility that our an-
have excluded the trivial
sense nt 162 and antisense nt 163) did not impair factor
tisense HpalI probe nonspecific inhibitors of Hp
contained
binding (data not shown), nor did cytosine methylation on
and A binding by performing a gel shift assay with combi-
sense strand nt 157 and 158 (Fig. 5). However, cytosine C-5
nations of mixed probes (data not shown).
methylation on the M-MuLV antisense strand at nt 159 and
160 drastically reduced complex A formation (Fig. 5). This
DISCUSSION result implies that factor A binding involves major groove
contacts at these nucleotides. That factor A might mediate
M-MuLV expression is restricted in EC cells. Although RBS repression is supported by the fact that MspI interfer-
virus integration occurs at normal levels (12, 35) steady-state ence and RBS mutant studies indicate the importance of
levels of RNA are decreased up to 100-fold in EC cells M-MuLV nt 160 in their effects.
relative to cell types. The retrovirus LTR
differentiated Although the binding characteristics of factor A suggest
promoter functions poorly in EC cells, at least partly be- that it may be the RBS repressor, several observations are
cause EC cells appear to lack a positive trans-acting factor(s) problematic. We observe factor A binding in both nuclear1220 PETERSEN ET AL. MOL. CELL. BIOL.
and cytoplasmic extracts from undifferentiated EC cells, leukemia virus, it is possible that the M-MuLV RBS plays a
which may be the result of nuclear contamination of our role in the regulation of the virus gene expression during
cytoplasmic extracts or may reflect the natural distribution T-cell differentiation. We are studying the expression of the
of this factor. Although there is precedent for localization of wt and m viral constructs in immature and mature T cells to
transcriptional factors in the cytoplasm (2, 3, 19), our ascertain the functional significance of this homology.
observations are complicated by the fact that the half-life of
binding factor A is 15 min in nuclear extracts but more than ACKNOWLEDGMENTS
60 min in cytoplasmic extracts. Another observation which We are indebted to Nancy Speck and Nancy Manley for advice
requires explanation is the identification of binding factor A and assistance concerning protocols and procedures. We thank
activity in differentiated NIH 3T3 cells (data not shown). Richard Scott for the communication of unpublished results. Thanks
Because the RBS effect is not observed in NIH 3T3 cells, our also to Scott Landfear, Jorge Crosa, and David Kabat for helpful
results with factor A are not compatible with a simple and informative discussions.
explanatory model. One possibility is that RBS repression This work was supported by grant MV416A from the American
does not involve factor A at all. However, it should be noted Cancer Society (National Chapter).
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
that factor binding may be the first in a series of steps leading REFERENCES
to regulation. 1. Antequara, F., D. Macleod, and A. P. Bird. 1989. Specific
One last complication concerning factor A binding to the protection of methylated CpGs in mammalian nuclei. Cell
RBS is the identification of factor Hp binding to the HpaII 58:509-517.
methylated wt probe (Fig. 5). DNA methylation has been 2. Baeuerle, P. A., and D. Baltimnore. 1988. Activation of DNA-
shown to play a significant role in controlling gene expres- binding activity in an apparently cytoplasmic precursor of the
sion (35), yet the control of DNA methylation is very poorly NF-K, transcription factor. Cell 53:211-217.
understood. Because EC cells demonstrate high levels of 3. Baeuerle, P. A., and D. Baltimore. 1988. IK: A specific inhibitor
CpG methylation (28, 35), it is possible that the Hp factor is of the NF-K13 transcription factor. Science 242:540-546.
4. Barklis, E., and H. Lodish. 1983. Regulation of dictyostelium
the functional RBS repressor and acts on methylated DNA, discoideum mRNAs specific for prespore or prestalk cells. Cell
rather than repression mediated by factor A at unmethylated 32:1139-1148.
sequences. In support of this scenario is the fact that Hp is 5. Barklis, E., R. C. Mulligan, and R. Jaenisch. 1986. Chromo-
unlike nonspecific CpG-binding proteins (1, 26), as demon- somal position or virus mutation permits retrovirus expression
strated by its requirement for RBS sense strand methylation in embryonal carcinoma cells. Cell 47:391-399.
(Fig. 5). However, global methylation of M-MuLV in EC 6. Bernstine, E., M. Hooper, S. Grandchamp, and B. Ephrussi.
cells appears to take more than 7 days (28), and we have 1973. Alkaline phosphatase activity in mouse teratoma. Proc.
observed RBS repression at 2 days postinfection by using Natl. Acad. Sci. USA 70:3899-3903.
luciferase reporter vectors (data not shown). Thus, unless 7. Colicelli, J., and S. Goff. 1987. Isolation of a recombinant
murine leukemia virus utilizing a new primer tRNA. J. Virol.
the RBS CpG is methylated much more rapidly than the bulk 57:37-45.
of the M-MuLV DNA (a possibility that we are testing), it 8. Cone, R., A. Weber-Benarous, D. Baorto, and R. Mulligan. 1987.
seems unlikely that initial M-MuLV repression in EC cells Regulated expression of a complete human 3-globin gene en-
involves the Hp factor. Nevertheless, we consider it possible coded by a transmissible retrovirus vector. Mol. Cell. Biol.
that factors A and Hp participate together in RBS regulation, 7:887-897.
with A and Hp repressing expression from unmethylated and 9. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983.
methylated sequences, respectively. With this in mind, it is Accurate transcription initiation by RNA polymerase II in a
of interest that although neither Hp nor factor A binds to soluble extract from isolated mammalian nuclei. Nucleic Acids
antisense HpaII hemimethylated probes, both factors bind Res. 11:1475-1489.
10. Evans, M. J., and M. H. Kaufman. 1981. Establishment in
to the wt sense hemimethylated probe. Therefore, immedi- culture of pluripotent cells from mouse embryos. Nature (Lon-
ately after replication of fully methylated DNA, daughter don) 292:154-156.
strands may differentially bind Hp and/or A factors. This 11. Feuer, F., M. Taketo, R. C. Hanecak, and H. Fan. 1989. Two
feature could be used to give daughter cells different devel- blocks in Moloney murine leukemia virus expression in undif-
opmental potentials. ferentiated F9 embryonal carcinoma cells as determined by
We do not know whether RBS homologs are used in the transient expression assays. J. Virol. 63:2317-2324.
normal regulation of cellular genes in EC cells. The 12. Gautsch, J., and M. Wilson. 1983. Restriction of moloney
M-MuLV RBS sequence contains no obvious identities with murine leukemia virus growth in teratocarcinoma: involvement
other nuclear-binding factor sites (16). However, in addition of factors other than DNA methylation. Cold Spring Harbor
Conf. Cell Proliferation 10:363-378.
to the expected homologies with a variety of retrovirus 13. Gorman, C., P. Rigby, and D. Lane. 1985. Negative regulation
PBSs, the M-MuLV RBS contains an unexpected homology of viral enhances in undifferentiated embryonic stem cells. Cell
to the 3'-noncoding region of the alpha chain of the T-cell 42:519-526.
receptor (TCR) (31): 14. Graham, F. L., and A. J. van der Eb. 1973. A new technique for
the assay of infectivity of human adenovirus 5 DNA. Virology
M-MuLV repressor site: 52:456-467.
5'GGGGG CTCGT CCGGG ATCGG GAGAC CCC 3' 15. Jaenisch, R., and A. Berns. 1977. Tumor virus expression during
mammalian embryogenesis, p. 267-314. In M. Sherman (ed.),
TCR 3' non-coding region: Concepts in mammalian embryogenesis. Massachusetts Insti-
5'cGGGG CTtcT CCtGG ATCtG aAGAC CCC 3' tute of Technology Press, Cambridge, Mass.
16. Jones, N. C., P. W. J. Rigby, and E. B. Ziff. 1988. Trans-acting
This homology is interesting because it maps to the TCR- protein factors and the regulation of eukaryotic transcription
alpha region that has been implicated in silencing TCR-alpha lessons from studies on DNA tumor viruses. Genes Dev.
gene expression in immature T cells (39). We do not know 2:267-281.
the significance, if any, of this similarity, because we have 17. Jones, T. A., G. Blaug, M. Hansen, and E. Barklis. 1990.
not examined whether the above sequence differences affect Assembly of gag-p-galactosidase proteins into retrovirus parti-
RBS function. Nevertheless, since M-MuLV is a T-cell cles. J. Virol. 64:2265-2279.VOL . 1 l, 1991 STEM CELL-SPECIFIC SILENCER 1221
18. Korman, A. J., J. D. Frantz, J. L. Strominger, and R. C. pendent mechanisms involved in suppression of the moloney
Mulligan. 1987. Expression of human class II major histocom- leukemia virus genome during differentiation of murine terato-
patibility complex antigens using retrovirus vectors. Proc. Natl. carcinoma cells. Cell 32:1105-1113.
Acad. Sci. USA 84:2150-2154. 29. Parker, B., and G. Stark. 1979. Regulation of simian virus 40
19. Levy, D. E., D. S. Kessler, R. Pine, and J. E. Darnell, Jr. 1989. transcription: sensitive analysis of the RNA species present
Cytoplasmic activation of ISGF3, the positive regulator of early in infection. J. Virol. 31:360-369.
interferon-a-stimulated transcription, reconstituted in vitro. 30. Peckham, I., S. Sobel, J. Comer, R. Jaenisch, and E. Barklis.
Genes Dev. 3:1362-1371. 1989. Retrovirus activation in embryonal carcinoma cells by
20. Linney, E., B. Davis, J. Overhauser, E. Chao, and H. Fan. 1984. cellular promoters. Genes Dev. 3:2062-2071.
Nonfunction of a moloney murine leukemia virus regulatory 31. Saito, H., D. Kranz, Y. Takagaki, A. Hayday, H. Eisen, and S.
sequence in F9 embryonal carcinoma cells. Nature (London) Tonegawa. 1984. A third rearranged and expressed gene in a
308:470-472. clone of cytotoxic T lymphocytes. Nature (London) 312:36-40.
21. Loh, T. P., L. L. Sievert, and R. W. Scott. 1987. Proviral 32. Shinnick, T., R. Lerner, and J. Sutcliffe. 1981. Nucleotide
sequences that restrict retroviral expression in mouse embryo-
nal carcinoma cells. Mol. Cell. Biol. 7:3775-3784. sequence of Moloney murine leukemia virus. Nature (London)
22. Loh, T. P., L. L. Sievert, and R. W. Scott. 1988. Negative 293:543-548.
Downloaded from http://mcb.asm.org/ on April 14, 2021 by guest
regulation of retrovirus expression in embryonal carcinoma 33. Speck, N. A., and D. Baltimore. 1987. Six distinct nuclear
cells mediated by an intragenic domain. J. Virol. 62:4086-4095. factors interact with the 75-base-pair repeat of moloney murine
23. Loh, T. P., L. L. Sievert, and R. W. Scott. 1990. Evidence for a leukemia virus enhancer. Mol. Cell. Biol. 7:1101-1110.
stem cell-specific repressor of Moloney murine leukemia virus 34. Stevens, L. 1967. The biology of teratomas. Adv. Morphol. 6:1.
expression in embryonal carcinoma cells. Mol. Cell. Biol. 35. Stewart, C., H. Stuhlman, D. Jahner, and R. Jaenisch. 1982. De
10:4045-4057. novo methylation, expression, and infectivity of retroviral ge-
24. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular nomes introduced into embryonal carcinoma cells. Proc. Natl.
cloning: a laboratory manual. Cold Spring Harbor Laboratory, Acad. Sci. USA 79:4088-4092.
Cold Spring Harbor, N.Y. 36. Teich, N., R. Weiss, G. Martin, and D. Lowy. 1977. Virus
25. Mann, R., R. Mulligan, and D. Baltimore. 1983. Construction of infection of murine teratocarcinoma stem cell lines. Cell 12:973-
a retrovirus packaging mutant and its use to produce helper-free 982.
defective retrovirus. Cell 33:153-159. 37. Thornell, A., B. Hallberg, and T. Grundstrom. 1988. Differential
26. Meehan, R., J. D. Lewis, S. McKay, E. L. Kleiner, and A. P. protein binding in lymphocytes to a sequence in the enhancer of
Bird. 1989. Identification of a mammalian protein that binds the mouse retrovirus SL3-3. Mol. Cell. Biol. 8:1625-1637.
specifically to DNA containing methylated CpGs. Cell 58:499- 38. Weiher, H., E. Barklis, W. Ostertag, and R. Jaenisch. 1987. Two
507. distinct sequence elements mediate retroviral gene expression
27. Miller, A., and C. Buttimore. 1986. Redesign of retrovirus in embryonal carcinoma cells. J. Virol. 61:2742-2746.
packaging cell lines to avoid recombination leading to helper 39. Winoto, A., and D. Baltimore. 1989. au lineage-specific repres-
virus production. Mol. Cell. Biol. 6:2895-2902. sion of the a T cell receptor gene by nearby silencers. Cell
28. Niwa, O., Y. Yokota, H. Ishida, and T. Sugahara. 1983. Inde- 59:649-655.You can also read
