PHOSPHORYLATION OF CORS AND CORR, REGULATORY PROTEINS THAT MODULATE PRODUCTION OF THE PHYTOTOXIN CORONATINE IN
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
FEMS Microbiology Letters 193 (2000) 13^18
www.fems-microbiology.org
Phosphorylation of CorS and CorR, regulatory proteins that
modulate production of the phytotoxin coronatine in
Pseudomonas syringae
Vidhya Rangaswamy, Carol L. Bender *
127 Noble Research Center, Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, OK 74078, USA
Received 1 September 2000; accepted 21 September 2000
Abstract
Production of the phytotoxin coronatine (COR) in Pseudomonas syringae pv. glycinea PG4180 is controlled by a modified two-
component regulatory system consisting of three genes, corR, corP, and corS. CorR and CorP show similarity to response regulators, and
CorS is related to histidine protein kinases that function as environmental sensors. In this study, CorR, CorP and the cytoplasmic portion of
CorS, designated CorSv, were overproduced in P. syringae as translational fusions to the maltose-binding protein and purified by affinity
chromatography. Autophosphorylation of CorSv was demonstrated when [Q-32 P]ATP was used as a phosphodonor. Phosphorylated CorSv
(CorSvVP) was stable under basic conditions, but extremely sensitive when the pH was reduced, which is consistent with phosphorylation
at a histidine residue. CorSvVP transferred its phosphoryl group to CorR but not to CorP, which correlates with the presence of a receiver
aspartate residue in the former but not the latter protein. These results indicate that CorS functions as a histidine protein kinase and
transphosphorylates CorR, a positive activator of cor gene transcription. ß 2000 Federation of European Microbiological Societies.
Published by Elsevier Science B.V. All rights reserved.
Keywords : Response regulator; Histidine protein kinase; Signal transduction
1. Introduction inducing phytotoxin produced by several P. syringae path-
ovars. COR consists of two distinct moieties that are
The phosphorylation cascades mediated by two-compo- joined by an amide linkage: (a) the polyketide coronafacic
nent regulatory systems provide microorganisms with acid (CFA), and (b) coronamic acid (CMA), an ethylcy-
mechanisms for responding to environmental stimuli. clopropyl amino acid [2]. COR biosynthesis has been thor-
These systems generally consist of a histidine protein ki- oughly investigated in P. syringae pv. glycinea PG4180,
nase (HPK) that monitors environmental changes and a where the 32-kb COR gene cluster is borne on a 90-kb
cytoplasmic response regulator (RR) that mediates the plasmid designated p4180A. The CFA gene cluster con-
output function [1]. Communication between the HPK sists of ten co-transcribed genes designated c£ and cfa1^9,
and RR begins with autophosphorylation of the HPK at and the CMA region contains four genes designated
a conserved histidine residue and phosphotransfer to a cmaA, cmaB, cmaT and cmaU [2].
conserved aspartyl residue in the RR. The CMA and CFA structural gene clusters in PG4180
Pseudomonas syringae is a Gram-negative, necrogenic are separated by a 3.4-kb regulatory region containing
bacterium that elicits a wide variety of symptoms on corR, corS and corP [3]. The translational products of
plants and is divided into pathogenic variants (pathovars), corP and corR show relatedness to the ROIII family of
which vary in host range. One of the most intensively RRs in two-component regulatory systems [4]. CorR is a
studied two-component regulatory systems in P. syringae transcriptional activator of CFA and CMA biosynthesis
controls the biosynthesis of coronatine (COR), a chlorosis- and binds to both the c£/CFA and cmaABT promoter
regions, respectively [5,6]. CorP lacks the HTH motif
that is present in CorR and does not bind the cor pro-
* Corresponding author. Tel. : +1 (405) 744-9945; moter regions [6]. Sequence analysis indicated that CorS
Fax: +1 (405) 744-7373; E-mail: cbender@okstate.edu was similar to HPKs that function as environmental sen-
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 4 5 4 - 7
FEMSLE 9673 16-11-0014 V. Rangaswamy, C.L. Bender / FEMS Microbiology Letters 193 (2000) 13^18
sors [3]. In this report, a truncated version of CorS (CorSv) 236 from accession no. U33327) and 5P-CAAAGCTTT-
was characterized in phosphorylation assays, and the role TAGCGCATTTCAACCAAA (see nucleotides 2874^
of CorR and CorP as phospho-acceptors was examined. 2892 in accession no. U33326); EcoRI and HindIII recog-
nition sites are in boldface, respectively. The 450-bp PCR
product was cloned into pMal-c2, resulting in pMalCorP.
2. Materials and methods For overproduction in P. syringae pv. glycinea PG4180,
both pMalCorSv and pMalCorP were linearized and li-
2.1. Bacterial strains, reagents, and DNA manipulations gated into pBBR1MCS, a vector that replicates in P. sy-
ringae, resulting in pVRCorSv and pVRCorP, respec-
P. syringae strains (Table 1) were cultured on mannitol^ tively. These two constructs and pAP06.415 (containing
glutamate (MG) medium [7] at 28³C. Escherichia coli cul- MBP^CorR) were introduced into P. syringae PG4180,
tures were grown in terri¢c broth (TB) or Luria^Bertani and translational fusions were induced by incubating cells
(LB) medium at 37³C [8]. Protein concentrations were de- in TB containing 1 mM IPTG at 18³C [5]. After induction,
termined with the Bio-Rad (Richmond, CA, USA) protein cells were incubated for 10 h, lysed by sonication, and
assay kit as recommended by the manufacturer. Antibiot- total cellular proteins were analyzed by SDS^PAGE. Fu-
ics were added to the media in the following concentra- sion proteins were puri¢ed by a¤nity chromatography on
tions (Wg ml31 ): ampicillin, 100; chloramphenicol, 25; ka- amylose resin (New England BioLabs, Beverly, MA,
namycin, 25; and tetracycline, 25. Polyclonal antisera to USA). MBP^CorR and MBP^CorP were cleaved with fac-
MBP^CorR was raised in rabbits by Bethyl Laboratories, tor Xa at 4³C for 20 h to release CorR and CorP, respec-
Inc. (Montgomery, TX, USA), and the ¢nal titer was tively, prior to phosphorylation assays. CorSv was puri-
1:16 000. Oligonucleotide synthesis and nucleotide se- ¢ed by loading the partially pure MBP^CorSv fusion to a
quencing were conducted by the Recombinant DNA and hydroxyapatite column and subjecting this to batchwise
Protein Resource Facility, Oklahoma State University. elution with increasing concentrations of sodium phos-
phate. A homogeneous preparation of MBP^CorSv was
2.2. Overproduction and puri¢cation of CorSv and CorP obtained with 200 mM sodium phosphate, cleaved with
factor Xa , and used in all subsequent assays.
CorSv, CorR and CorP were overproduced as transla-
tional fusions to the C-terminus of the maltose-binding 2.3. Peptide sequencing and phosphorylation assays
protein (MBP) encoded by malE. pAP06.415 contains
the MBP^CorR fusion and has been described elsewhere CorSv was puri¢ed as described above and electropho-
[5]. The C-terminal hydrophilic portion of holo-CorS was resed on a 12% SDS^PAGE gel. The 37-kDa band was
ampli¢ed by PCR and cloned into pMal-c2 as a 1-kb excised, partially digested with trypsin, and peptide frag-
BamHI-HindIII fragment. Primers used for PCR ampli¢- ments were separated by HPLC and sequenced by Edman
cation were : 5P-GGCGGATCCGTCGGTGATGACCTG degradation [9]. Tryptic digests and sequencing of peptide
and 5P-GCAAGCTTCCCCTCATCACACTCC; BamHI fragments was completed at the Molecular Biology Re-
and HindIII sites are in boldface, respectively (see Gen- source Facility, University of Oklahoma Health Science
Bank accession no. U33326). The 1-kb PCR product was Center.
cloned in pMal-c2, resulting in pMalCorSv. The primers Phosphorylation assays were performed in a 10-Wl vol-
used for ampli¢cation of corP included: 5P-ATTGAATT- ume containing 60 mM Tris^HCl (pH 7.6), 3.5 mM DTT,
CATGCCGAGCTCTTCGAGCTTG (nucleotides 216^ 0.8 mM EDTA, 5 mM MgCl2 , 60 mM KCl and 0.1 mM
Table 1
Bacterial strains and plasmids used in this study
Strain or plasmid Relevant characteristics Reference or source
E. coli
DH5K v(lacZYA-argF)U169 [8]
P. syringae pv. glycinea
PG4180 COR [18]
Plasmids
pBluescript II SK+ Apr , ColEI origin Stratagene
pMal-c2 Apr , ColE1 origin, tac promoter, encodes malE and lacZK, contains factor Xa cleavage site New England Biolabs
pBBR1MCS Cmr , broad host-range cloning vector [19]
pMalCorSv Apr , contains truncated corS as a 1-kb BamHI-HindIII fragment in pMal-c2 This study
pVRCorSv Cmr , pMalCorSv fused to pBBR1MCS This study
pMalCorP Apr , contains corP as a 450-bp EcoRI-HindIII fragment in pMal-c2 This study
pVRCorP Cmr , pMalCorP fused to pBBR1MCS This study
pAP06.415 Apr Tcr , contains corR as a malE fusion; overproduces MBP^CorR in P. syringae [5]
FEMSLE 9673 16-11-00V. Rangaswamy, C.L. Bender / FEMS Microbiology Letters 193 (2000) 13^18 15
[Q-32 P]ATP. Assays were initiated by the addition of CorSv 3. Results
(80^100 ng), incubated at 28³C for 30 min, and terminated
by adding 5 Wl of loading bu¡er (133 mM Tris^HCl (pH 3.1. Overproduction and puri¢cation of CorSv and CorP in
8.8), 3.3 mM EDTA, 0.6 M sucrose, 0.06% (w/v) bromo- P. syringae
phenol blue, 6% (w/v) SDS, 0.1 M DTT, and 1.6% (v/v)
L-mercaptoethanol) and incubating for 3 min at 55³C. After induction with IPTG, PG4180(pVRCorSv) cells
Samples were then analyzed by SDS^PAGE and autora- contained a protein band corresponding to an Mr of
diography. Protein concentrations were determined using 79 kDa, which is consistent with the predicted size of
the Bio-Rad Phosphor Imaging system, Model GS-700 the MBP^CorSv fusion (42+37 kDa) (Fig. 1A, lane 2).
Densitometer, and Molecular Analyst software (Version However, the MBP^CorP fusion produced by PG4180-
2.1) as described previously [5]. (pVRCorP) was approximately 50 kDa (Fig. 1B, lane 2),
In phosphotransfer assays, puri¢ed CorSv was auto- which is 8 kDa smaller than the predicted mass [3]. Rese-
phosphorylated for 30 min as described above. CorR or quencing of corP revealed a stop codon 174 bp down-
CorP (1^2 Wg) was then added to the CorSvVP reaction stream from the translational start, resulting in a protein
mixture and incubated an additional 30 min. Phosphory- with an Mr approximately 50% less than that previously
lation was terminated as described above, and reactions predicted for CorP. Because the mass of the MBP^CorP
were analyzed by electrophoresis and autoradiography. fusion was consistent with the presence of the new stop
codon in corP, the nucleotide sequence was modi¢ed ac-
2.4. Stability of phosphorylated CorSv cordingly (GenBank accession no. U33327). MBP^CorSv
and MBP^CorP were overproduced as soluble fusions,
The stability of the CorSvVP phosphoramidate linkage puri¢ed by a¤nity chromatography, and cleaved with fac-
was examined by adding HCl or NaOH to a ¢nal concen- tor Xa to release CorSv and CorP, respectively (Fig. 1A,
tration of 0.5 or 1 M, respectively [10]. Reactions were B).
incubated for 30 min at 28³C, neutralized and analyzed
by autoradiography. The stability of CorSv^P was also 3.2. Autophosphorylation of CorSv
investigated in a time course experiment where CorSv
was initially phosphorylated in a 90-Wl volume, and 10- Regardless of the incubation period, MBP^CorSv was
Wl aliquots were removed at 5, 15, and 30 min, and 1, 2, not phosphorylated by [Q-32 P]ATP (data not shown), pos-
3, 4, and 5 h. sibly because MBP sterically hinders transphosphorylation
Fig. 1. Overproduction and puri¢cation of MBP^CorSv and MBP^CorP from P. syringae PG4180. A: Protein pro¢le of PG4180 producing MBP^
CorSv on 12% SDS^PAGE. Lanes: 1, total proteins from uninduced cells of PG4180(pVRCorSv); 2, PG4180(pVRCorSv) cells induced with IPTG ;
3, MBP^CorSv puri¢ed from P. syringae by a¤nity chromatography; 4, MBP^CorSv cleaved with factor Xa protease. The migration of molecular
mass markers is indicated on the left. B: P. syringae PG4180 overproducing MBP^CorP. Lanes: 1, total proteins from uninduced cells of
PG4180(pVRCorP) ; 2, PG4180(pVRCorP) cells induced with IPTG ; 3, MBP^CorP puri¢ed from P. syringae by a¤nity chromatography ; 4, MBP^
CorP cleaved with factor Xa protease. Proteins in lanes 1 and 2 were separated on 12% SDS^PAGE ; proteins in lanes 3 and 4 were electrophoresed on
15% SDS^PAGE. The sizes (in kDa) of MBP^CorP (50), MBP (42), and CorP (8) are indicated on the left. C: Autophosphorylation of MBP^CorSv
cleaved with factor Xa for the following incubation periods : lane 1, 1 h; lane 2, 2 h; lane 3, 3 h; and lane 4, 20 h. The amount of protein loaded to
each lane was 100 ng. The size of the phosphorylated band (37 kDa) is indicated on the right.
FEMSLE 9673 16-11-0016 V. Rangaswamy, C.L. Bender / FEMS Microbiology Letters 193 (2000) 13^18
Fig. 2. Phosphorylation assays with CorSv. A: Autophosphorylation of CorSv (80 ng) as a function of time. Phosphorylation assays were conducted in
a reaction volume of 100 Wl, and a 10-Wl aliquot was removed at the following times: lane 1, 5 min; lane 2, 15 min; lane 3, 30 min; lane 4, 1 h; lane
5, 2 h; lane 6, 3 h; lane 7, 4 h; and lane 8, 5 h. Samples were loaded to 12% SDS^PAGE, and gels were autoradiographed. B: Substrate speci¢city of
CorSv autophosphorylation. All lanes contain 80 ng CorSv, and the phosphorylation assay was performed as described in Section 2 with the following
changes: lane 1, no change; lane 2, MgCl2 was omitted ; lane 3, 250 WM ADP was added; lane 4, [K-32 P]ATP was substituted for [Q-32 P]ATP ; and lane
5, [Q-32 P]GTP was substituted for [Q-32 P]ATP. C: Autophosphorylation as a function of protein concentration. Autophosphorylation was conducted as
described in Section 2 with the following amounts of CorSv. Lanes: 1, 7.5 ng; 2, 15 ng; 3, 30 ng; 4, 37.5 ng; 5, 45 ng; 6, 60 ng; 7, 75 ng; and 8,
150 ng. D: Chemical stability of phosphorylated CorSv. CorSv was autophosphorylated as described in Section 2 (lane 1) and incubated with 0.5 M
HCl (lane 2) or 1 M NaOH (lane 3).
of CorSv. However, a protein corresponding to the pre- phorylated forms of NarX and NarQ, HPKs that sense
dicted size of CorSv (37 kDa) was autophosphorylated nitrate in E. coli [11].
(Fig. 1C, lane 1). In-gel tryptic digestion of CorSv and
peptide sequencing con¢rmed that the phosphorylated 3.3. Phosphorylation of CorR by CorSvVP
protein in Fig. 1C was CorSv. Phosphorylation of CorSv
increased when MBP^CorSv was incubated with factor Xa The addition of CorR to CorSvVP resulted in a pat-
for increasing periods of time (Fig. 1C, lanes 1^4) and was tern of labeling consistent with the formation of CorRVP
maximal at 3 h (Fig. 2A, lane 6). (Fig. 3A, lanes 2^5). CorRVP was detectable within 5 s
The addition of KCl did not stimulate CorSv autophos- (Fig. 3A, lane 2), and the amount remained constant for
phorylation (data not shown); however, the omission of up to 5 min (Fig. 3A, lanes 2^5). After cross-absorption
MgCl2 from the reaction mixture decreased the autophos- with CorR antiserum prior to phosphotransfer, the 18-
phorylation of CorSv (Fig. 2B, lane 2). The addition of kDa band disappeared, thus con¢rming its identity as
250 WM ADP completely inhibited CorSv autophosphor- CorR (data not shown). It is important to mention that
ylation (Fig. 2B, lane 3) which was reported for other the concentration of labeled CorSvVP continued to in-
HPKs [11]. When [K-32 P]ATP was used as a phosphodo- crease during the phosphotransfer reaction (Fig. 3A, lanes
nor instead of [Q-32 P]ATP, no labeling of the protein oc- 2^5), probably because [Q-32 P]ATP was still present in the
curred (Fig. 2B, lane 4), indicating that only the Q-phos- reaction mixture. The increased labeling of CorSvVP at
phate of ATP was transferred to CorSv. Furthermore, later time points may indicate that phosphotransfer to
[Q-32 P]GTP could not substitute for [Q-32 P]ATP in the au- CorR is rate-limiting.
tophosphorylation reaction (Fig. 2B, lane 5). In the pres- When CorSvVP was incubated with CorP, phosphor-
ence of [Q-32 P]ATP and MgCl2 , CorSv autophosphoryla- ylation of CorP was not observed regardless of the incu-
tion increased linearly as a function of protein bation time (Fig. 3B, lanes 2^5). In a subsequent experi-
concentration (Fig. 2C, lanes 1^8). ment, CorSvVP was incubated with both CorR and CorP
CorSvVP was extremely sensitive to acidic conditions to determine if these response regulators functioned in a
(Fig. 2D, lane 2), but stable under basic conditions (Fig. phosphorelay. Although CorR functioned as a phospho-
2D, lane 3), which is consistent with a phosphoramidate acceptor in this experiment, there was no phosphorylation
linkage (histidinyl^phosphate) [10]. The stability of of CorP, even during prolonged incubation times (data
CorSvVP was also examined by removing 10-Wl aliquots not shown).
of the phosphorylated protein at di¡erent times and ana-
lyzing these by SDS^PAGE and autoradiography. No de-
crease in the phosphorylation of CorSv was apparent even 4. Discussion
after 5 h, indicating that CorSvVP was very stable (data
not shown). Similar results were reported for the phos- Both CorR and CorP show similarity to RRs that are
FEMSLE 9673 16-11-00V. Rangaswamy, C.L. Bender / FEMS Microbiology Letters 193 (2000) 13^18 17
phosphorylated by HPKs. Residues that are invariant
within the RR family correspond to Asp-12, Asp-13,
Asp-57 (the site of phosphorylation), and Lys-109 in
CheY [12]. The N-terminal regions of CorR and CorP
are almost identical when aligned and contain aspartate
residues at positions 10 and 11 (Fig. 4), which is similar to
Asp-12 and Asp-13 in CheY. Sequence analysis indicated
that CorR has an aspartate at residue 55 [3], which is
likely to be the site of phosphorylation. However, unlike
CorR, CorP lacks the active site aspartate, the conserved
lysine, and the HTH motif (Fig. 4). These characteristics
are consistent with the inability of CorSvVP (or
CorRVP) to phosphorylate CorP and the failure of
CorP to bind cor promoter regions [6].
Fig. 4. Domain organization of the regulatory proteins that modulate
Genetic studies using mutants defective in corR, corP,
COR production in P. syringae. In CorR, the amino acids conserved in
and corS previously established that all three genes were other response regulators (D10, D11, D55 and K104) and the location
essential for COR production and cor gene transcription of the HTH motif are indicated. The active site aspartate (D55) is
[3,13]. In the current study, CorSv was autophosphory- marked with an asterisk. CorP is almost identical to CorR at the N-ter-
lated by [Q-32 P]ATP and the transphosphorylation of minus but lacks the active site aspartate, conserved lysine (K104), and
HTH motif. CorS, the histidine protein kinase, possesses six potential
CorR by CorSvVP was observed within 5 s (Fig. 3A,
membrane-spanning segments (see ¢lled rectangles). The location of a
lane 2), suggesting that CorR may be the cognate response leucine zipper (LZ) motif, which may catalyze formation of a CorS
dimer, is also indicated. The active site histidine (H box) is marked with
an asterisk. The G1, F and G2 boxes are predicted to constitute part of
the ATP-binding domain in HPK [4]. CorSv lacks the hydrophobic N-
terminus of CorS but contains the catalytic histidine residue and puta-
tive ATP-binding domain.
regulator for CorS. In previous studies, CorR functioned
as a positive activator of cor gene expression and bound to
the c£/CFA and cmaABT transcripts [5,6]. Although ge-
netic studies indicated that corP was required for COR
production, the role of CorP in the regulation of COR
biosynthesis remains unclear.
When analyzed for hydrophobicity using PROSIS
TMpred and the method of Kyte and Doolittle [14],
CorS contained six putative transmembrane segments at
the N-terminus (Fig. 4). Although most membrane-local-
ized HPKs possess two transmembrane regions with a
single extracytoplasmic loop, several HPKs have been
identi¢ed with multiple transmembrane regions [15]. Di-
merization is also an important factor in the stimulation
and regulation of HPK activity [1]. Previous studies have
shown that leucine zippers (LZs) are involved in homo- or
Fig. 3. Phosphotransfer experiments. A: CorSv (100 ng) was autophos-
heterodimer formation through a coiled-coil structure, and
phorylated and CorR (2 Wg) was added to the reaction (lane 1 contains a coiled-coil, LZ motif has been identi¢ed in the mem-
the reaction mixture before CorR was added). Aliquots of the reaction brane-spanning regions of several HPKs [16,17]. The LZ
were removed and analyzed after the addition of CorR at the following in the periplasmic domain of EnvZ was shown to have
times : lane 2, 5 s; lane 3, 30 s; lane 4, 1 min ; and lane 5, 5 min. The
both structural (dimerization) and functional (osmosen-
migration of molecular mass markers (kDa) is indicated on the left, and
phosphorylated bands corresponding to CorSvVP and CorRVP are
sory) roles [17]. Interestingly, the N-terminus of CorS con-
noted on the right. B: CorSv (100 ng) was autophosphorylated as de- tains a putative LZ that spans amino acid residues 137^
scribed in Section 2, and CorP (1.8 Wg) was added to the reaction (lane 165 (Fig. 4). It is tempting to speculate that the LZ in
1 contains the reaction mixture before CorP was added). Aliquots of CorS is involved in the dimerization and `sensory' activ-
the reaction were removed after CorP was added and analyzed on 18%
ities of this protein, which could be explored by construct-
SDS^PAGE at the following times: lane 2, 5 s; lane 3, 30 s; lane 4,
1 min; and lane 5, 5 min. The migration of molecular mass markers
ing mutated versions of CorS with amino acid substitu-
(kDa) is indicated on the left, and the phosphorylated band correspond- tions in this motif.
ing to CorSvVP is indicated on the right. To our knowledge, this is the ¢rst report where a pro-
FEMSLE 9673 16-11-0018 V. Rangaswamy, C.L. Bender / FEMS Microbiology Letters 193 (2000) 13^18
tein isolated from P. syringae has been shown to function [8] Sambrook, J.E., Fritsch, E.F. and Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory
as a HPK and phosphorylate a response regulator. When
Press, Cold Spring Harbor, NY.
they were obtained from E. coli, both CorSv and CorR [6] [9] Baker, C.S. and Dunn, M.J. (1994) Preparation of proteins from gels
were devoid of kinase and DNA-binding activity, respec- for protein microsequencing. In: Methods in Microbiology, Vol. 32:
tively, which made it necessary to purify these proteins Basic Protein and Peptide Protocols (Walker, J.M., Ed.), pp. 177^
from P. syringae. Our approaches and results will be use- 184. Humana Press, Totowa, NJ.
[10] Janiak-Spens, F., Sparling, J.M., Gur¢nkel, M. and West, A.H.
ful to other researchers who are investigating two-compo-
(1999) Di¡erential stabilities of phosphorylated response regulator
nent regulatory systems in P. syringae. domains re£ect functional roles of the yeast osmoregulatory SLN1
and SSK1 proteins. J. Bacteriol. 181, 411^417.
[11] Schro«der, I., Wolin, C.D., Cavicchioli, R. and Gunsalus, R.P. (1994)
Acknowledgements Phosphorylation and dephosphorylation of the NarQ, NarX and
NarL proteins of the nitrate-dependent two-component regulatory
system of Escherichia coli. J. Bacteriol. 176, 4985^4992.
The authors thank A. Pen¬aloza-Väzquez and A. West [12] Stock, A.M., Martinez-Hackert, E., Rasmussen, B.F., West, A.H.,
for reviewing the manuscript prior to submission. C.L.B. Stock, J.B., Ringe, D. and Petsko, G.A. (1993) Structure of the
acknowledges support from National Science Foundation Mg2 -bound form of CheY and mechanism of phosphoryl transfer
grant MCB-9603618. in bacterial chemotaxis. Biochemistry 32, 13375^13380.
[13] Liyanage, H., Palmer, D.A., Ullrich, M. and Bender, C.L. (1995)
Characterization and transcriptional analysis of the gene cluster for
coronafacic acid, the polyketide component of the phytotoxin coro-
References natine. Appl. Environ. Microbiol. 61, 3843^3848.
[14] Kyte, J. and Doolittle, R.F. (1982) A simple method for displaying
[1] Goudreau, P.N. and Stock, A.M. (1998) Signal transduction in bac- the hydropathic character of a protein. J. Mol. Biol. 157, 105^132.
teria: molecular mechanisms of stimulus-response coupling. Curr. [15] Piazza, F., Tortosa, P. and Dubnau, D. (1999) Mutational analysis
Opin. Microbiol. 1, 160^169. and membrane topology of ComP, a quorum-sensing histidine kinase
[2] Bender, C.L., Alarcön-Chaidez, F. and Gross, D.C. (1999) Pseudo- of Bacillus subtilis controlling competence development. J. Bacteriol.
monas syringae phytotoxins: mode of action, regulation and biosyn- 181, 4540^4548.
thesis by peptide and polyketide synthetases. Microbiol. Mol. Biol. [16] Singh, M., Berger, B., Kim, P.S., Berger, J.M. and Cochran, A.G.
Rev. 63, 266^292. (1998) Computational learning reveals coiled coil-like motifs in histi-
[3] Ullrich, M., Pen¬aloza-Väzquez, A., Bailey, A.M. and Bender, C.L. dine kinase linker domains. Proc. Natl. Acad. Sci. USA 95, 2738^
(1995) A modi¢ed two-component regulatory system is involved in 2743.
temperature-dependent biosynthesis of the Pseudomonas syringae [17] Yaku, H. and Mizuno, T. (1997) The membrane-located osmosensory
phytotoxin coronatine. J. Bacteriol. 177, 6160^6169. kinase, EnvZ, that contains a leucine zipper-like motif functions as a
[4] Parkinson, J.S. and Kofoid, E.C. (1992) Communication modules in dimer in Escherichia coli. FEBS Lett. 417, 409^413.
bacterial signaling proteins. Annu. Rev. Genet. 26, 71^112. [18] Bender, C., Liyanage, H., Palmer, D., Ullrich, M., Young, S. and
[5] Pen¬aloza-Väzquez, A. and Bender, C.L. (1998) Characterization of Mitchell, R. (1993) Characterization of the genes controlling biosyn-
CorR, a transcriptional activator which is required for biosynthesis of thesis of the polyketide phytotoxin coronatine including conjugation
the phytotoxin coronatine. J. Bacteriol. 180, 6252^6259. between coronafacic acid and coronamic acid. Gene 133, 31^38.
[6] Wang, L., Bender, C.L. and Ullrich, M.S. (1999) The transcriptional [19] Kovach, M.E., Phillips, R.W., Elzer, P.H., Roop III, R.M. and Pe-
activator CorR is involved in biosynthesis of the phytotoxin corona- terson, K.M. (1994) pBBR1MCS : a broad-host-range cloning vector.
tine and binds to the cmaABT promoter region in a temperature- Biotechniques 16, 800^802.
dependent manner. Mol. Gen. Genet. 262, 250^260.
[7] Keane, P.J., Kerr, A. and New, P.B. (1970) Crown gall of stone fruit.
II. Identi¢cation and nomenclature of Agrobacterium isolates. Aust.
J. Biol. Sci. 23, 585^595.
FEMSLE 9673 16-11-00You can also read