Developing liveShigellavaccines using k Red recombineering
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Developing live Shigella vaccines using k Red recombineering
Ryan T. Ranallo, Shoshana Barnoy, Sejal Thakkar, Tonia Urick & Malabi M. Venkatesan
Department of Enteric Infections, Division of Communicable Diseases and Immunology, Walter Reed Army Institute of Research, Silver Spring, MD, USA
Correspondence: Ryan T. Ranallo, Abstract
Department of Enteric Infections, Division of
Communicable Disease and Immunology,
Live attenuated Shigella vaccines have shown promise in inducing protective
Walter Reed Army Institute of Research, 503 immune responses in human clinical trials and as carriers of heterologous antigens
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
Robert Grant Ave., Silver Spring, MD 20910, from other mucosal pathogens. In the past, construction of Shigella vaccine strains
USA. Tel.: 11 301 3199517; relied on classical allelic exchange systems to genetically engineer the bacterial
fax: 11 301 3199801; e-mail: genome. These systems require extensive in vitro engineering of long homologous
ryan.ranallo@na.amedd.army.mil sequences to create recombinant replication-defective plasmids or phage. Alter-
natively, the l red recombination system from bacteriophage facilitates recombi-
Received 22 August 2005; revised 1 January
nation with as little as 40 bp of homologous DNA. The process, referred to as
2006; accepted 24 April 2006.
First published online 9 June 2006.
recombineering, typically uses an inducible l red operon on a temperature-
sensitive plasmid and optimal transformation conditions to integrate linear
doi:10.1111/j.1574-695X.2006.00118.x antibiotic resistance cassettes flanked by homologous sequences into a bacterial
genome. Recent advances in recombineering have enabled modification of
Editor: Jennelle Kyd genomic DNA from bacterial pathogens including Salmonella, Yersinia, entero-
pathogenic Escherichia coli, or enterohemorrhagic E. coli and Shigella. These
Keywords advances in recombineering have been used to systematically delete virulence-
Shigella vaccine; recombination; attenuation. associated genes from Shigella, creating a number of isogenic strains from multiple
Shigella serotypes. These strains have been characterized for attenuation using both
in vivo and in vitro assays. Based on this data, prototypic Shigella vaccine strains
containing multiple deletions in virulence-associated genes have been generated.
Introduction these genes and Shigella pathogenesis warrants investigation
with the intention of further attenuating vaccine strains and
Original methodologies for attenuating virulent bacteria and expanding the window of safety between immunogenicity
viral pathogens included chemical mutagenesis and serial and reactogenicity.
passage through nonpermissive hosts. These early approaches Various plasmid and phage-based systems are available for
lacked specificity and have been replaced by techniques based genetically engineering bacterial genomes via homologous
on genetic engineering and homologous recombination. This recombination. The most widely used system involves en-
process, sometimes referred to as reverse genetics, is based on gineering recombinant replication-defective plasmids (sui-
targeted deletion of virulence-associated genes and has been cide vectors) to contain long stretches of homology flanking
facilitated by a more complete understanding of pathogenic the gene to be deleted (Hamilton et al., 1989; Donnenberg &
mechanisms, genome sequencing efforts and in vivo homo- Kaper, 1991; Blomfield et al., 1991; Metcalf et al., 1996;
logous recombination techniques. Philippe et al., 2004). Construction of such recombinant
For enteric pathogens like Shigella, reverse genetics has plasmids requires extensive in vitro manipulations, making
led to a number of live vaccine strains with deletions in both the process of modifying bacterial genomes time consuming
metabolic and virulence-associated genes (Karnell et al., and incompatible with the high throughput mutagenesis
1995; Coster et al., 1999; Kotloff et al., 1996, 2000, 2002, techniques prevalent in the post genomics era. Nevertheless,
2004; Katz et al., 2004). However, the recent availability of this system has proven extremely useful in genetically en-
genomic and plasmid sequences from Shigella flexneri has gineering numerous bacterial pathogens, including Shigella.
lead to the identification of many new genes that may A relatively new technique for genetic engineering via
contribute to Shigella virulence (Buchrieser et al., 2000; homologous recombination in bacteria has emerged which
Venkatesan et al., 2001; Jin et al., 2002; Wei et al., 2003; utilizes the proteins Beta, Exo and Gam from l bacterioph-
Venkatesan & Burland, 2004). The relationship between age (reviewed in Court et al., 2002). This system promotes
Journal compilation
c 2006 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 47 (2006) 462–469
Published by Blackwell Publishing Ltd. No claim to original US government worksl Red recombineering to develop Shigella 463
homologous recombination of linear DNA with as little as Mosely (Hartman & Venkatesan, 1998) and Shigella dysen-
40 bp of homologous DNA sequence. The process of genetic teriae 1 strain 1617 (Mendizabal-Morris et al., 1971).
engineering using phage-encoded recombination functions Parental strains (2457 T, Mosley, and 1617) were routinely
is referred to as ‘recombineering’ and has been used to grown on LB media and Tryptic Soy Agar plates containing
modify the genomes of Escherichia coli, Yersinia, Salmonella, 0.05% Congo Red (w/v). Where appropriate, ampicillin
enterohemorrhagic E. coli, enteropathogenic E. coli and (50 mg mL1), kanamycin (20 mg mL1) and chlorampheni-
Shigella (Murphy & Campellone, 2003; Ohya et al., 2005 col (12.5 mg mL1) were added to growth media for selec-
and refs therein). The technique has several advantages over tion. Strains containing either pCP20 or pKM208 were
the classical allelic exchange system, including increased incubated at 30 1C unless otherwise noted below.
recombination efficiency, smaller regions of homology and,
most importantly, less time associated with constructing Linear DNA transformation procedure
recombinant plasmids.
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
The methodology presented in this work uses Beta, Exo The transformation procedure for recombineering experi-
and Gam expressed from pKM208 (Murphy & Campellone, ments was very similar to the protocol described previously
2003) to promote homologous recombination between the (Murphy & Campellone, 2003). Briefly, plasmid pKM208
Shigella genome and short regions of homologous DNA supplies the l Red functions under the control of the Ptac
sequence adjacent to antibiotic resistance cassettes. Recom- promoter and the lacI repressor. Freshly streaked strains
bineering has been used to systematically engineer gene transformed with pKM208 were grown at 30 1C in ampi-
deletions on both the large invasion plasmid and chromo- cillin (50 mg mL1) to early log phase (OD 0.12–0.17) and
some. Construction of these mutants has allowed the IPTG was added at a final concentration of 1 mM. Cultures
characterization of known and unknown virulence determi- were incubated for an additional hour at 30 1C and then heat
nants in different Shigella serotypes. Based on these data, shocked at 42 1C for 15 min. Cells were harvested, washed in
multiple attenuating lesions have been incorporated into a ice-cold 1 mM MOPS, 20% glycerol, concentrated 100-fold
wild-type Shigella background, producing prototypic live and electroporated (2.0 kV and 200 O) with a PCR fragment
attenuated Shigella vaccine strains. (0.25–1.0 mg) obtained from either pKD3 or pKD4 or
Shigella genomic DNA when appropriate. Cells were trans-
ferred to sterile 15 mL culture tubes after adding 1.0 mL of
Materials and methods SOC media and incubated at 37 1C for at least 1 h and plated
on LB agar plates containing the appropriate concentration
Bacterial strains, growth conditions and media of antibiotic.
Plasmids
Linear DNA preparation
Escherichia coli strains carrying plasmids pKD3, pKD4, and
Linear DNA containing antibiotic resistance genes were
pCP20 (Datsenko & Wanner, 2000) were obtained from
prepared from pKD3 or pKD4 using the method described
B. Wanner by means of the E. coli Genetic Stock Center,
by Datsenko and Wanner (2000). Primers for PCR reactions
Department of MCDB, 830 KBT, Yale University. The
were designed to contain 50 bp of homology to the gene of
plasmid pKM208 was obtained from Kenan Murphy (Mur-
interest as well as P1 and P2 sites used to prime from pKD3
phy & Campellone, 2003). The plasmids pKD3 and pKD4
or pKD4. Linear antibiotic resistance cassettes with ex-
are p dependent and carry chloramphenicol and kanamycin
tended ( 450 bp) homology to the gene of interest were
resistance genes, respectively, flanked by FLP recombinase
prepared using genomic DNA from an isogenic mutant
recognition sites (FRT sites). The pCP20 plasmid contains a
which still retained the antibiotic resistance cassette. Primers
temperature sensitive replicon and the yeast FLP recombi-
designed for insert verification (below) were typically re-
nase transcribed from the lpR promoter under the control
cycled and used to generate cassettes with homologous DNA
of the l cI857 repressor (Cherepanov & Wackernagel, 1995).
sequence greater than 50 bp. PCR reactions were carried out
The pKM208 is a temperature sensitive plasmid which
using Taq polymerase according to the manufacturer’s
contains the l red genes (gam, bet, exo) under the control
(Invitrogen) recommendations.
of the Ptac promoter controlled by the lacI repressor gene
(Murphy & Campellone, 2003).
Genomic and reverse transcriptase PCR
Genomic PCR analysis was carried out by colony PCR.
Shigella strains and growth conditions
Briefly, colonies were resuspended in 50 mL of water and
Three wild-type Shigella strains were used; S. flexneri 2a boiled for 10 min to make DNA lysates. Each lysate was
strain 2457 T (Kotloff et al., 1995), Shigella sonnei strain assayed using the appropriate primer set by PCR. PCR
FEMS Immunol Med Microbiol 47 (2006) 462–469 Journal compilation c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. No claim to original US government works464 R.T. Ranallo et al.
reactions were carried out using Taq polymerase according L-glutamine. Prior to adding bacteria, each Petri dish was
to the manufacturer’s recommendation (Invitrogen). The washed using Hanks’ balanced salt solution. Log-phase
following primers were used to generate Figs 2a–c: Primer bacterial cultures (OD600 0.3–0.4) were serially diluted in
(A) Set1A con1 (CGGGGATGCCCGTCAGGTCA); Primer prewarmed Hanks’ balanced salt solution and 0.2 mL was
(B) Set1A con2 (AGAGGTACCTTCCTCCGGAA); Primer added to each 60 mm dish. Petri dishes were incubated for
(C) C1 (TTATACGCAAGGCGACAAGG); Primer (D) C2 45 min at 37 1C in 5% CO2 with rocking every 15 min.
(GATCTTCCGTCACAGGTAGG); Primer (E) 5 0 Shet2-1 Plaques were developed as described in Oaks et al. (1985).
ORF (CGGGTATCTGTCTGTGTACT); Primer (F) 3 0 Shet2-1 Plaque sizes were determined by calculating the average size
ORF (GCACTAGAAATAAGTACATC); Primer (G) Shet2- of 10 plaques per 60 mm plate using a Finescale Comparator
1 con (ACGTATTCGTACGGTGAATCCG); Primer (H) (Finescale).
Shet2-1 con2 (AGGTCTTCAGGCACTGCTTA); Primer (I) Invasion assays were performed as described previously
5 0 rrsH ATGGCGCATACAAAGAGAAG; Primer (J) 3 0 rrsH (Ranallo et al., 2005). Sereny or challenge assays were
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
ACTTCATGGAGTCGAGTTGC. performed as described (Ranallo et al., 2005) except that
Recombination efficiencies were calculated as defined in naı̈ve guinea pigs weighing 175–250 g were used. Approxi-
Table 1 from a single experiment unless no positive recom- mately 5 108 CFU in 25 mL of saline was inoculated in the
binants were identified. conjunctive sac of naı̈ve guinea pigs. The degree of inflam-
RNA for reverse transcriptase PCR (RT-PCR) was col- mation was evaluated for 5 days. Results were scored on day
lected from log-phase cultures (OD 0.2–0.3) grown in LB 3: 0 indicates no inflammation or mild disease, 1 indicates
media at 37 1C. Bacteria were collected by centrifugation and mild keratoconjunctivitis, 2 indicates keratoconjunctivitis
total RNA was isolated using the RNeasy Midi Kit from without purulence, 3 indicates severe keratoconjunctivitis
Qiagen. The isolation was carried out using the Qiagen with purulence. Research was conducted in compliance with
protocol for bacteria. To remove any DNA that may have the Animal Welfare Act and other federal statutes and
been left over after the RNA purification, the RNase-Free regulations relating to animals and experiments involving
DNase Set from Qiagen was used according to the manu- animals adhered to the principles stated in the Guide for the
facturer’s recommendation. The purified RNA was then Care and Use of Laboratory Animals.
used to generate cDNA that could be used in an RT-PCR
reaction.
For the RT-PCR reaction, total RNA of 5 mg in no more
Results and discussion
than 13 mL was added to a microcentrifuge tube. To this was
added 1 mL of random hexamer (50 ng mL1), 1 mL of 10 mM Expression of the l red (gam,p bet, exo) genes from lambda
dNTPs and enough RNase free water to bring the total phage significantly increases the efficiency of short homo-
volume to 15 mL. The tubes containing this mixture were logy recombination in gram-negative bacteria including
than heated to 70 1C for 5 min and then cooled on ice for numerous enteric pathogens (Murphy & Campellone, 2003;
5 min. This process allowed the primer to anneal to the Ohya et al., 2005). A number of protocols and plasmids for
RNA. Then the following was added to the tube: 2.5 mL RT short homology recombination have been developed and are
Buffer (10 ), 1 mL RNase Inhibitor, 1 mL AMLV RT enzyme readily available (Datsenko & Wanner, 2000; Murphy &
and 5.5 mL RNase free water. The tube was then incubated at Campellone, 2003). The present work uses short homology
42 1C for 2 h. The cDNA was used in PCR reactions that recombination to systematically delete genes in Shigella for
were carried out as stated above. Primers A and B were used the purpose of assessing gene-specific virulence, inflamma-
for the set1A gene, E and F for the sen gene and I and J for tory potential and immunogenicity. The data gained from
the rrsH gene shown in Fig. 2c. DNA contamination was this approach will translate into rationally designed live
monitored by including PCR reactions on RNA that was not attenuated Shigella vaccine strains.
treated with RT. None of the samples yielded an amplified The IPTG inducible plasmid pKM208 and transforma-
product when tested with each primer set (data no shown). tion protocol developed by Murphy and colleagues (Murphy
& Campellone, 2003) was used for short homology recom-
bination in Shigella. This low copy plasmid allows for tight
Phenotypic characterization of isogenic mutants regulation of the l Red genes. Furthermore, it has a
Plaque assays were performed as described (Oaks et al., temperature-sensitive origin of replication and can be
1985) with some minor modifications. BHK cells were eliminated by nonselective growth at 37 1C. Additional
substituted for HeLa cells and grown to confluency in plasmids (pKD3, pKD4 and pCP20) contribute to the over-
60 mm tissue culture treated Petri dishes at 37 1C and 5% all deletion scheme adapted from Datsenko and Wanner
CO2 in complete Minimal Essential Medium (cMEM) (2000). These plasmids enable incorporation of the FLP-
containing 10% fetal bovine serum (FBS), and 2 mM mediated recombination step, leaving behind an 80 bp scar
Journal compilation
c 2006 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 47 (2006) 462–469
Published by Blackwell Publishing Ltd. No claim to original US government worksl Red recombineering to develop Shigella 465
Fig. 1. Schematic representation of a gene dis-
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
ruption strategy adopted from Datsenko & Wan-
ner (2000). (a) Linear DNA substrates containing
antibiotic resistance cassettes are generated using
PCR primers with 50 bp homology (H1 and H2) to
the gene of interest (yfg). Priming from either
pKD3 or pKD4 produces linear DNA substrates. (b)
These substrates are treated with Dpn1 purified
and introduced into bacteria made transiently
hyper-recombinogenic using Gam, Beta, Exo ex-
pressed from pKM208. (c) The cassette is elimi-
nated via plasmid-based expression of a yeast-
derived recombinase (FLP) leaving behind an
80 bp ‘scar’ consisting of a single FRT site.
(FRT site) and strains devoid of antibiotic resistance genes serotype (Table 1). The difference in efficiency between
and thus minimizing polar effects (Fig. 1). serotypes is possibly related to the accuracy of genomic
Over 13 different isogenic strains have been generated as sequence information, as S. sonnei and S. dysenteriae gen-
part of the first step in a systematic approach to assessing omes were not available at the time the experiments were
virulence, inflammatory potential and immunogenicity. The done. The genomic diversity between serotypes is likely a
strains include mutants of S. flexneri (2457 T strain) (Kotloff consequence of the large number of insertion sequences
et al., 1995), S. dysenteriae 1 (1617 strain) (Mendizabal- found in Shigella. Consistent with previous reports, dele-
Morris et al., 1971) and S. sonnei (Mosely strain) (Hartman tions up to 10 kb were generated using recombineering
& Venkatesan, 1998, Table 1). Deletions included metabolic [WRSd1(stxAB) in Table 1].
genes involved in intracellular growth and survival (asd), as Attenuation of Shigella resulting in robust immune
well as virulence genes responsible for enterotoxic activity responses and reduced clinical symptoms in humans has
(set, sen and stxAB) and intra- and intercellular spread (virG been demonstrated through deletion of both metabolic
or icsA). Transformations with pKM208 containing Shigella (guaBA, aroA, aroD) and virulence-associated genes (virG,
strains typically produced 0–250 antibiotic resistant colo- set, sen, stxAB) (A. L. Bourgeois, pers. comm.; T. L. Hale,
nies. PCR analysis to identify proper recombination events pers. comm.; Karnell et al., 1995; Coster et al., 1999; Kotloff
were anywhere from 0% to 100% positive for gene replace- et al., 1996, 2000, 2002, 2004; Katz et al., 2004). The
ment (Table 1). Each gene replacement was verified by virulence gene, virG or icsA, is a primary target for attenua-
genomic PCR using one or more primer sets, which anneal tion because strains containing this mutation are unable to
to specific locations on either the chromosome or invasion spread to contiguous host cells and are avirulent in animal
plasmid depending on the location of the gene (Figs 2a and models (Bernardini et al., 1989; Sansonetti & Arondel,
b). An example of this type of analysis is given in Figs 2a and 1989). In fact, data collected from recent clinical studies
b, where the proper insertion of a chloramphenicol resis- have indicated that Shigella vaccine strains with mutations
tance cassette into the set1A and sen gene is shown. For some in virG (SC602, WRSS1, WRSd1) are highly immunogenic
strains RT-PCR analysis was done to ensure no transcript and safe when given to humans at low doses (A. L.
was present in the deletion strain (Fig. 2c). Bourgeois, pers. comm.; T. L. Hale, pers. comm.; Coster
The efficiency of an individual replacement seemed et al., 1999; Kotloff et al., 2002; Katz et al., 2004). A more
dependent on the gene location, antibiotic cassette orienta- recent clinical trial comparing CVD1204(guaBA) and
tion, the number of previous deletions, and the Shigella CVD1208(guaBA, set, sen) found that deletion of the
FEMS Immunol Med Microbiol 47 (2006) 462–469 Journal compilation c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. No claim to original US government works466 R.T. Ranallo et al.
Table 1. Summary of isogenic mutants in 2457T (Shigella flexneri 2a), Mosely (Shigella sonnei) and 1617 (Shigella dysenteriae 1)
Strain Serotype Virulence associated Gene function % efficiencyw
WRSf2(DvirG) S. flexneri Yes Cell-to-cell spread 95
WRSf2(Dasd) S. flexneri No Cell wall synthesis 15
WRSf2(Dset1A) S. flexneri Yes Enterotoxin 100z
WRSf2(Dsen) S. flexneri Yes Enterotoxin 60
WRSf2(DmsbB2) S. flexneri Yes Lipid A acylation 0–77‰
WRSf2(DmsbB1) S. flexneri Yes Lipid A acylation 100
WRSf2(DuhpT) S. flexneri Unknown Sugar transporter 4
WRSf2(DipaH9.8) S. flexneri Yes Inflammation 96
WRSd1(DstxAB) S. dysenteriae Yes Enterotoxin 5
WRSd1(DvirG) S. dysenteriae Yes Cell-to-cell spread 92
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
WRSs(DvirG) S. sonnei Yes Cell-to-cell spread 22
WRSs(Dsen) S. sonnei Yes Enterotoxin 40
WRSs(DipaB) S. sonnei Yes Invasion 32
Assessed in human or animal models.
w
Defined as the percent positive relative to the total tested.
z
Only one recombinant was recovered after transformation.
‰
Efficiency is dependent on the orientation of the antibiotic resistance cassette.
enterotoxins set and sen significantly reduced vaccine-asso- One of the primary mechanisms associated with Shigella
ciated diarrhea, fever and vaccine shedding when compared pathogenesis is its ability to invade, replicate and dissemi-
to guaBA alone (Kotloff et al., 2004). Based on these nate within epithelial cells of the colonic mucosa. The initial
findings, isogenic mutants in each of these virulence-asso- process of eukaryotic cell invasion can be monitored in vitro
ciated genes WRSf2(virG), WRSf2(set), WRSf2(sen) were using the gentamicin protection assay (Elsinghorst, 1994).
constructed in a S. flexneri 2a (2457 T) background and Gentamicin protection assays revealed that each strain
evaluated for virulence using both in vivo and in vitro assays. [WRSf2(virG), WRSf2(set), WRSf2(sen)] was capable of
Fig. 2. Genomic PCR from wild-type Shigella
flexneri strain 2457T and isogenic mutants made
using recombineering. Genomic DNA was pre-
pared from 2457T ([a] and [b]; lanes 2, 4, and 6),
WRSf2(Dset1A) ([a]; lanes 3,5, and 7) and
WRSf2(Dsen) ([b]; lanes 3,5, and 7). PCR analysis
was performed using three different primers sets
in (a) (A1C, D1B and A1B) and three in
(b) (G1C, D1H and E1F). The predicted length
of each PCR product is indicated below each
schematic. (c) RT-PCR from 2457T (lanes 2, 4 and
6), WRSf2(Dsen) (lanes 3 and 7), and
WRSf2(Dset1A) (lanes 5 and 8) was performed
using the appropriate primer sets as described in
Materials and methods. Message from the 16S
rRNA gene (rrsH) was used as a positive
control for cDNA synthesis. Lanes 1 and
8 ([a] and [b]) and lanes 1 and 9 (c) are DNA
standards indicated in bp. A nonspecific product
that is generated from primer C alone under
certain PCR conditions is indicated with an
asterisk.
Journal compilation
c 2006 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 47 (2006) 462–469
Published by Blackwell Publishing Ltd. No claim to original US government worksl Red recombineering to develop Shigella 467
Table 2. Sereny reaction in guinea pigs
Challenge strain No. of eyes inoculated Average rating
Normal saline 4 0
2457T 8 3
WRSf2(DvirG) 8 0
WRSf2(Dset) 8 3
WRSf2(Dsen) 8 3
Shigella vaccine strains containing multiple gene deletions
have been generated using short homology recombination or
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
recombineering (data not shown). In addition to virG, these
strains contain deletions in the two enterotoxins genes set and
sen. A number of interesting issues were raised while con-
structing strains with multiple gene deletions. For example,
when a strain contained two or more deletions it was some-
Fig. 3. Characterization of Shigella isogenic mutants in a plaque assay. times necessary to use an antibiotic resistance cassette with
Wild-type Shigella flexneri 2a 2457T and an S. flexneri 2a invasion- greater than 50 bp of homology to obtain a high percentage
negative control strain were assayed along with the isogenic mutants
of recombinants. Additional difficulties encountered in-
WRSf2(DvirG), WRSf2(Dsen), and WRSf2(Dset). Each strain was assayed
cluded the large number of noninvasive colonies observed
twice with the total number of plaques and the average plaque size
recorded. As expected, WRSf2(DvirG) was plaque negative, whereas following FLP-mediated cassette removal. It was sometimes
both WRSf2(Dsen) and WRSf2(Dset) formed plaques identical to 2457T. necessary to screen hundreds of colonies following cassette
removal to find a strain with the correct recombination event.
The decrease in gene replacement efficiency is likely due to
invading HeLa cells with wild-type efficiency (data not the FRT sites still present after each antibiotic cassette is
shown). A plaque assay was then used to monitor not only removed. These residual FRT sites have the potential to direct
invasion but also inter- and intracellular spread. Plaque recombination in the wrong location due to presence of FRT
assays performed with each isogenic strain revealed that sites on the incoming antibiotic resistance cassette.
only the virG mutation in WRSf2(virG) significantly re- Altogether, our results demonstrate that recombineering
duced plaque formation (Fig. 3). Both the set and sen is a rapid and efficient method for generating gene deletions
deletions in 2457 T were wild type with regards to both in Shigella. Furthermore, this method can be used to
plaque size (average size 1.0 mm) and efficiency, indicating generate potential vaccine strains containing multiple gene
that these two enterotoxins did not appear to affect bacterial deletions. Preclinical testing of these strains is needed to test
invasion, intracellular replication or dissemination within safety and immunogenicity and is currently underway. As
epithelial cell monolayers. Additional virulence testing in- additional genomes representing diverse Shigella serotypes
cluded the keratoconjunctivitis model (Sereny test), an assay are completed and analyzed, recombineering can be used to
used to measure among other things the degree of attenua- rapidly test potential virulence factors that may contribute
tion of candidate Shigella vaccines. Consistent with the to serotype-specific virulence as well as to rapidly generate
plaque assay, only WRSf2(DvirG) was attenuated in the attenuated strains for use as live oral vaccines.
Sereny test (Table 2).
Several virG-based Shigella vaccines from different species
such as SC602 (S. flexneri 2a), WRSS1 (S. sonnei) and WRSd1 Acknowledgements
(S. dysenteriae 1) have been tested and found to be safe in
We thank Kenan Murphy for the pKM208 plasmid and his
human volunteers at low oral doses (Karnell et al., 1995;
protocol for recombineering experiments. We also thank
Coster et al., 1999; Kotloff et al., 2002; A. L. Bourgeois, pers.
Dhruba Chattoraj and Diane Taylor for valuable suggestions
comm.; T. L. Hale, pers. comm.; Katz et al., 2004). It is clear
on the protocols, Wilfried Wackernagel for the pCP20
from these clinical trials that attenuation beyond deletion of
plasmid and Barry Wanner for the pKD3 and pKD4 plasmids.
virG may be required to generate a vaccine that is free from
any residual reactogenic symptoms in North American
volunteers. It is also clear from recently published clinical
trials that at least part of this reactogenicity may be attributed
Disclaimer
to the presence of enterotoxins in the Shigella genome (Kotl- The content of this publication does not necessarily reflect
off et al., 2004). Based on these findings several potential the views or policies of the Department of the Army, or the
FEMS Immunol Med Microbiol 47 (2006) 462–469 Journal compilation c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. No claim to original US government works468 R.T. Ranallo et al.
U.S. Department of Defense, nor does the mention of trade Shigella flexneri 2a vaccine SFL1070 with a deleted aroD gene
names, commercial products or organizations imply endor- in adult Swedish volunteers. Vaccine 13: 88–99.
sement by the U.S. Government. Katz DE, Coster TS, Wolf MK, Trespalacios FC, Cohen D, Robins
G, Hartman AB, Venkatesan MM, Taylor DN & Hale TL
(2004) Two studies evaluating the safety and immunogenicity
References of a live, attenuated Shigella flexneri 2a vaccine (SC602) and
excretion of vaccine organisms in North American volunteers.
Bernardini ML, Mounier J, d’Hauteville H, Coquis-Rondon M & Infect Immun 72: 923–930.
Sansonetti PJ (1989) Identification of icsA, a plasmid locus of Kotloff KL, Nataro JP, Losonsky GA, Wasserman SS, Hale TL,
Shigella flexneri that governs bacterial intra- and intercellular Taylor DN, Sadoff JC & Levine MM (1995) A modified Shigella
spread through interaction with F-actin. Proc Natl Acad Sci
volunteer challenge model in which the inoculum is
USA 86: 3867–3871.
administered with bicarbonate buffer: clinical experience
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
Blomfield IC, Vaughn V, Rest RF & Eisenstein BI (1991) Allelic
and implications for Shigella infectivity. Vaccine 13:
exchange in Escherichia coli using the Bacillus subtilis sacB
1488–1494.
gene and a temperature-sensitive pSC101 replicon. Mol
Kotloff KL, Noriega F, Losonsky GA, Sztein MB, Wasserman SS,
Microbiol 5: 1447–1457.
Nataro JP & Levine MM (1996) Safety, immunogenicity, and
Buchrieser C, Glaser P, Rusniok C, Nedjari H, D’Hauteville H,
Kunst F, Sansonetti P & Parsot C (2000) The virulence plasmid transmissibility in humans of CVD 1203, a live oral Shigella
pWR100 and the repertoire of proteins secreted by the type III flexneri 2a vaccine candidate attenuated by deletions in aroA
secretion apparatus of Shigella flexneri. Mol Microbiol 38: and virG. Infect Immun 64: 4542–4548.
760–771. Kotloff KL, Noriega FR, Samandari T, Sztein MB, Losonsky GA,
Cherepanov PP & Wackernagel W (1995) Gene disruption in Nataro JP, Picking WD, Barry EM & Levine MM (2000)
Escherichia coli: TcR and KmR cassettes with the option of Flp- Shigella flexneri 2a strain CVD 1207, with specific deletions in
catalyzed excision of the antibiotic-resistance determinant. virG, sen, set, and guaBA, is highly attenuated in humans.
Gene 158: 9–14. Infect Immun 68: 1034–1039.
Coster TS, Hoge CW, VanDeVerg LL, et al. (1999) Vaccination Kotloff KL, Taylor DN, Sztein MB, et al. (2002) Phase I evaluation
against shigellosis with attenuated Shigella flexneri 2a strain of delta virG Shigella sonnei live, attenuated, oral vaccine
SC602. Infect Immun 67: 3437–3443. strain WRSS1 in healthy adults. Infect Immun 70:
Court DL, Sawitzke JA & Thomason LC (2002) Genetic 2016–2021.
engineering using homologous recombination. Annu Rev Kotloff KL, Pasetti MF, Barry EM, Nataro JP, Wasserman SS,
Genet 36: 361–388. Sztein MB, Picking WD & Levine MM (2004) Deletion in the
Datsenko KA & Wanner BL (2000) One-step inactivation of Shigella enterotoxin genes further attenuates Shigella flexneri
chromosomal genes in Escherichia coli K-12 using 2a bearing guanine auxotrophy in a phase 1 trial of CVD 1204
PCR products. Proc Natl Acad Sci USA 97: and CVD 1208. J Infect Dis 190: 1745–1754.
6640–6645. Mendizabal-Morris CA, Mata LJ, Gangarosa EJ & Guzman G
Donnenberg MS & Kaper JB (1991) Construction of an eae (1971) Epidemic Shiga-bacillus dysentery in Central America.
deletion mutant of enteropathogenic Escherichia coli by Derivation of the epidemic and its progression in Guatemala,
using a positive-selection suicide vector. Infect Immun 59:
1968–69. Am J Trop Med Hyg 20: 927–933.
4310–4317.
Metcalf WW, Jiang W, Daniels LL, Kim SK, Haldimann A &
Elsinghorst EA (1994) Measurement of invasion by gentamicin
Wanner BL (1996) Conditionally replicative and conjugative
resistance. Methods Enzymol 236: 405–420.
plasmids carrying lacZ alpha for cloning, mutagenesis, and
Hamilton CM, Aldea M, Washburn BK, Babitzke P &
allele replacement in bacteria. Plasmid 35: 1–13.
Kushner SR (1989) New method for generating deletions
Murphy KC & Campellone KG (2003) Lambda Red-mediated
and gene replacements in Escherichia coli. J Bacteriol 171:
recombinogenic engineering of enterohemorrhagic and
4617–4622.
Hartman AB & Venkatesan MM (1998) Construction of a enteropathogenic E. coli. BMC Mol Biol 4: 11.
stable attenuated Shigella sonnei DeltavirG vaccine strain, Oaks EV, Wingfield ME & Formal SB (1985) Plaque formation by
WRSS1, and protective efficacy and immunogenicity in the virulent Shigella flexneri. Infect Immun 48: 124–129.
guinea pig keratoconjunctivitis model. Infect Immun 66: Ohya K, Handa Y, Ogawa M, Suzuki M & Sasakawa C (2005)
4572–4576. IpgB1 is a novel Shigella effector protein involved in bacterial
Jin Q, Yuan Z & Xu J (2002) Genome sequence of Shigella flexneri invasion of host cells: its activity to promote membrane
2a: insights into pathogenicity through comparison with ruffling via RAC1 and CDC42 activation. J Biol Chem.
genomes of Escherichia coli K12 and O157. Nucleic Acids Res Philippe N, Alcaraz JP, Coursange E, Geiselmann J &
30: 4432–4441. Schneider D (2004) Improvement of pCVD442, a suicide
Karnell A, Li A, Zhao CR, Karlsson K, Nguyen BM & Lindberg AA plasmid for gene allele exchange in bacteria. Plasmid 51:
(1995) Safety and immunogenicity study of the auxotrophic 246–255.
Journal compilation
c 2006 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 47 (2006) 462–469
Published by Blackwell Publishing Ltd. No claim to original US government worksl Red recombineering to develop Shigella 469
Ranallo RT, Fonseka CP, Cassels F, Srinivasan J & Venkatesan MM Virulence Genes to Enterobacterial Pathogenesis, pp. 395–411.
(2005) Construction and characterization of bivalent Shigella ASM Press, Washington, DC.
flexneri 2a vaccine strains SC608(pCFAI) and SC608(pCFAI/ Venkatesan MM, Goldberg MB, Rose DJ, Grotbeck EJ, Burland V
LTB) that express antigens from enterotoxigenic Escherichia & Blattner FR (2001) Complete DNA sequence and analysis of
coli. Infect Immun 73: 258–267. the large virulence plasmid of Shigella flexneri. Infect Immun
Sansonetti PJ & Arondel J (1989) Construction and evaluation of 69: 3271–3285.
a double mutant of Shigella flexneri as a candidate for oral Wei J, Goldberg MB, Burland V, et al. (2003) Complete
vaccination against shigellosis. Vaccine 7: 443–450. genome sequence and comparative genomics of Shigella
Venkatesan MM & Burland V (2004) Genomic-Scale Analysis of flexneri serotype 2a strain 2457T. Infect Immun 71:
Virulence Plasmids: The Contribution of Plasmid-Borne 2775–2786.
Downloaded from https://academic.oup.com/femspd/article/47/3/462/508192 by guest on 09 January 2021
FEMS Immunol Med Microbiol 47 (2006) 462–469 Journal compilation c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. No claim to original US government worksYou can also read
