HMG1-Related DNA-Binding Protein Isolated with V-(D)-J Recombination Signal Probes - Molecular and ...
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, Sept. 1991, p. 4528-4536 Vol. 11, No. 9
0270-7306/91/094528-09$02.00/0
Copyright ©D 1991, American Society for Microbiology
HMG1-Related DNA-Binding Protein Isolated with V-(D)-J
Recombination Signal Probes
MASAKI SHIRAKATA,"12 KONRAD HUPPI,3 SADAKAZU USUDA,1 KENJI OKAZAKI,2t
KAZUYA YOSHIDA,' AND HITOSHI SAKANO1*
Division of Immunology, Department of Molecular and Cell Biology, University of California, Berkeley,
California 947201; Division of Gene Regulation, Tsukuba Center for Life Science, Institute of
Physical and Chemical Research, Tsukuba 305, Japan2; and Laboratory of
Genetics, National Cancer Institute, Bethesda, Maryland 208923
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
Received 26 March 1991/Accepted 13 June 1991
In order to isolate cDNA clones for DNA-binding components of the V-(D)-J recombinase, phage libraries
from a pte-B-cell line were screened with a radiolabeled probe containing recombination signal sequences
(RSS). Among prospective clones, cDNA T160 was analyzed further. It produced a protein of 80.6 kDa which
bound to DNA containing RSS but not to DNA in which the RSS had been mutated. A search of a data base
revealed that the T160 protein has significant sequence homology (56%) to the nonhistone chromosomal protein
HMG1 within the C-terminal region of 80 amino acids. DNA-binding analysis with truncated proteins showed
that the HMG homology region is responsible for DNA binding. Using restriction fragment length polymor-
phisms, the T160 gene was mapped at the proximal end of mouse chromosome 2. Evidence was obtained for
genetic linkage between the T160 gene and the recombination activator genes RAG-1 and RAG-2.
Somatic-DNA recombination activates and diversifies libraries made from a recombination-competent pre-B-cell
variable-region genes of antigen receptors (29, 51). This line. Among positive clones isolated with the RSS probe,
DNA rearrangement, known as V-(D)-J joining, occurs one type of cDNA, T160, was analyzed further. Nucleotide
between two pairs of recombination signal sequences (RSS), sequencing revealed that the T160 protein has significant
i.e., a heptamer (5'-CACAGTG-3') and a nonamer (5'- homology in the DNA-binding domain with the HMG1
GGTTTTTGT-3'), when one pair is separated by a 12-bp protein. HMG1 is a member of the high-mobility group
spacer and the other is separated by a 23-bp spacer (9, 12, 35, (HMG) proteins, which are nonhistone chromosomal com-
42-44). Substrate requirements and the effects of base sub- ponents (22). HMG1 was also identified as a cruciform-
stitutions have been studied in detail for recombination DNA-binding protein that may play an important role in
signal sequences (2, 18). For the enzymatic machinery, DNA replication or recombination (3). Although the T160
several nuclear proteins have been reported as having pos- protein is much larger than other HMG members, the
sible endonucleolytic activities (11, 19, 25) or as being hydrophilic region of T160 has a strong homology to HMG1.
DNA-binding components of the putative V-(D)-J recombi- In order to study whether the T160 gene has a genetic
nase (1, 16, 17, 32, 34). linkage to scid or rag, the chromosomal location for T160
Two chromosomal locations have been reported for re- was determined. Using restriction fragment length polymor-
combination functions associated with V-(D)-J joining. A phism segregation analysis, genetic linkage was established
defect in DNA recombination has been observed in the scid for T160 and RAG genes on the proximal end of chromo-
mouse, CB-17 scid (5), in which V-(D)-J joining is apparently some 2. In this report, we characterize the T160 protein and
impaired in both B and T cells. Extensive DNA deletions are discuss its possible role in V-(D)-J recombination.
found at recombination junctions in the scid animal (33, 39).
The CB-17 scid gene has been mapped to mouse chromo-
some 16 (6). Recently, two genes that can activate V-(D)-J MATERIALS AND METHODS
joining were isolated by introducing chromosomal DNA cDNA library. Total RNA was prepared from a pre-B-cell
fragments into the fibroblast cell line NIH 3T3 (38, 46, 47). line, 38B9 (4), according to the manufacturer's protocol
These genes have been referred to as RAG-1 and RAG-2, for (Amersham) and passed through an oligo(dT)-cellulose col-
recombination-activating genes. At present, it is not clear umn three times to obtain poly(A)+ RNA. cDNA was
whether they merely activate recombination or code for the synthesized by the method of Gubler and Hoffman (15) using
recombinase itself. Although homology of RAG-1 to topoi- oligo(dT) and random hexanucleotides as primers. The
somerases has been pointed out by Wang et al. (54), no cDNA was ligated with an EcoRI adaptor (Pharmacia) and
DNA-binding activity or catalytic function has been reported then ligated to Agtll arms. The cDNA library of 3 x 106
for the RAG gene product. The rag locus has been mapped recombinant phage was amplified only once before screen-
to chromosome 2 (19a). ing. The average length of cDNA inserts is 1.2 kb.
In order to isolate cDNA clones for RSS-binding compo- RSS probes. The 12-bp RSS of VK21lC and the RSS of its
nents of the putative recombinase, we screened Xgtll phage mutant were synthesized and cloned into the EcoRI-BamHI
site of the plasmid pUC18. The mutant 12-bp RSS DNA has
*
Corresponding author. a single base change (C-*G) in the heptamer sequence at the
t Present address: Division of Genetic Information, Institute of third position from the recombination site. For phage screen-
Molecular Life Science, Kurume Medical College, Kurume 830, ing, a concatemer of the 12-bp RSS was used. A BglII linker
Japan. was inserted at the EcoRI site of pUC18 for cloning concate-
4528VOL . 1 l, 1991 HMG1-RELATED DNA-BINDING PROTEIN 4529
mers. The 12-bp RSS were excised from the plasmid clone protein or 3-galactosidase were prepared from antigen-
by digestion with BglII and BamHI following ligation. The injected guinea pigs. Proteins for immunization were ob-
concatemerized RSS DNA was recloned into the BamHI site tained from the Y1089 E. coli lysogen of XT160 or Agtll as
of pUC18. A tetramer of the 12-bp RSS was chosen for described elsewhere (20) and purified by preparative gel
screening the library. To make the probe, plasmid DNA was electrophoresis (31). The proteins were eluted from poly-
digested with XbaI and Asp 718 and then end-labeled with acrylamide gels using ELUTRAP (Schleicher & Schuell) and
[a-32P]dCTP by using the Klenow fragment of Escherichia concentrated by filtration (Amicon). For Western blotting,
coli DNA polymerase. The probe DNA was purified on a 5% 38B9 cells were collected and washed with phosphate-
polyacrylamide gel. Monomer RSS probes were prepared buffered saline. Cells (10 ml of culture) were homogenized
from plasmids in basically the same way as described above by sonication in 0.4 ml of an extraction buffer (10 mM Tris
for the concatemer probe. HCl [pH 7.5], 0.15 M NaCl, 10 mM EDTA, 1 mM phenyl-
Screening of Agtll library. Phage screening was performed methylsulfonyl fluoride, 0.4% [vol/vol] Nonidet P-40). Pro-
as described by Singh et al. (49). Phage were plated at a teins (1 jig) were separated on a 7.5% SDS-polyacrylamide
density of 4 x 104 in a plate (7 by 22 cm) for the first gel (31) and transferred to a nitrocellulose filter (52). The
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
screening. After the transfer of plaques, nitrocellulose filters filter was then preincubated with 2% (wt/vol) skim milk
were preincubated with 5% (wt/vol) skim milk (Difco) in (Difco) and incubated with guinea pig sera (300x dilution).
TNE-150 buffer (50 mM Tris HCl [pH 7.5], 0.15 M NaCl, 1 Goat anti-guinea pig immunoglobulin G-biotin conjugate
mM EDTA, 1 mM dithiothreitol) and incubated with the (Sigma) was used for the second antibody at a dilution of 1 to
32P-labeled tetramer probe (106 cpm/ml) in TNE-150 buffer at 1,000. Biotin was detected by using alkali phosphatase-
room temperature for 1 h. Filters were individually sealed in conjugated avidin (Vectastain). Protein concentrations were
plastic bags for binding. The filters were washed twice for 10 determined by Bradford's method (7).
min with TNE-150 at room temperature and exposed to DNA affinity chromatography. RSS DNA-Sepharose resin
Kodak XAR film for 24 h at -80°C with an intensifying was prepared according to the method of Kadonaga and
screen. To purify the positive phage, plaque binding was Tjian (24). The RSS DNA used for affinity resin was the
repeated three times with 10-cm dishes. 12-bp RSS 5'-GATCTGAGCCACAGTGAGCATCGATTCC
Southwestern (DNA-protein) analysis. Lysogens of Agtll, ACAAAAACCTGCTG-3', which had a spacer sequence
XT160, and XT140 were isolated in E. coli Y1089 (20). For different from that of the 12-bp RSS used for phage screen-
high-level expression of 3-galactosidase fusion proteins, ing. Reticulocyte lysate (40 p.l) containing the in vitro-
cells were incubated at 45°C for 15 min and then cultured at synthesized T160 protein was diluted with 200 jul of the
37°C for 1 h in the presence of 10 mM isopropyl-p-D- binding buffer (20 mM Tris HCl [pH 7.5], 10 mM MgCl2, 1
thiogalactopyranoside. Cells from 1.5-ml cultures were pel- mM dithiothreitol, 10% [vol/vol] glycerol, 0.01% [vol/vol]
leted and suspended in 200 ,ul of sodium dodecyl sulfate- Nonidet P-40, 10 ng of bovine serum albumin per ml). The
polyacrylamide gel electrophoresis (SDS-PAGE) sample lysate was incubated with S jig of poly(dI-dC) at room
buffer (31). Protein samples were separated in 10% SDS- temperature for 5 min and applied to an RSS DNA affinity
polyacrylamide gels and transferred electrophoretically to column (0.3 ml). The column was washed extensively with
nitrocellulose filters in 25 mM Tris-190 mM glycine (pH the binding buffer containing 0.1 M KCl. Proteins were
8.3)-20%o (vol/vol) methanol (52). The filters were denatured eluted with 0.6 M KCl, precipitated with 3% (wt/vol) tri-
and renatured as described by Celenza and Carlson (8). After chloroacetic acid, and analyzed by SDS-PAGE (31).
renaturation, the filters were bound to probes as described Isolation of T160 gene. Genomic clones for T160 were
above for phage screening except that monomeric probes isolated from the mouse (BALB/c) genomic library using a
were used. 1.7-kb EcoRI fragment of T160 cDNA.
Sequencing of cDNA clones. DNA sequencing was per- Genomic probes for chromosome mapping. T160 probes
formed with double-stranded templates according to the were 5- and 6-kb EcoRI fragments of the genomic clone
method of Sanger et al. (45) using Sequenase Version 2.0 containing both the coding and 3'-flanking sequences. The
(USB). The cDNA insert of AT160 was subcloned into RAG-1 probe was a 0.5-kb EcoRI fragment from the 5'
Bluescript KS+ plasmid (Stratagene). Deletion clones of region of the mouse cDNA which was isolated with oligo-
T160 were made using exonuclease III (Toyobo) and mung nucleotide probes made according to the published sequence
bean nuclease (Toyobo). Both strands of DNA were se- (47).
quenced. The T160 sequence was analyzed with GenBank
(Version 65.0) data bases using the FASTA algorithm (40). RESULTS
For the predicted amino acid sequence, the National Bio-
medical Research Foundation protein sequence data base Isolation of RSS-binding clones. cDNA libraries were pre-
(Version 25.0) was used with the FASTP program, which pared from poly(A)+ RNA isolated from a recombination-
also had the FASTA algorithm. competent pre-B-cell line, 38B9 (4). Both oligo(dT) and
In vitro transcription and translation. For in vitro protein random hexanucleotides were used as primers in making the
synthesis, the T160 cDNA was cloned into the EcoRI site of cDNA. The cDNA was then ligated to Agtll phage arms
the EK+ vector. The vector was modified from Bluescript after the addition of EcoRI adaptors. The library contained a
SK+ (Stratagene) by removing a part of the polylinker site total of 3.5 x 106 plaques and cDNA inserts with an average
from SacII to PstI. The EcoRI site was located immediately size of 1.2 kb. Recombinant phage expressing cDNA-en-
downstream from the T3 promoter. The T160-containing coded proteins were screened as described by Singh et al.
plasmid (pEK160) was linearized with Asp 718. RNA was (49) by using a double-stranded concatemer probe of the
transcribed with T3 RNA polymerase and a CAP analog 12-bp RSS. In the initial experiment, the majority of clones
(Stratagene). For translation, 1 to 2 jig of RNA was incu- isolated were nonspecific DNA-binding proteins. Based on
bated with nuclease-treated rabbit reticulocyte lysates their sequence homologies, they were classified into two
(Promega) in the presence of [35S]methionine. separate groups, A3 and A10. Both types of clones showed
Western (inmunoblot) analysis. Antibodies for the fusion significant binding with 32P-labeled plasmid DNA. Isolation4530 SHIRAKATA ET AL. MOL. CELL. BIOL.
A Southwestern experiment, the 90-kDa protein could be used
Coo massie
Sta tining
Southwestern as an internal standard (Fig. 1A). It appears that binding with
Drobe 12bD-RSS o!.:1t RSS 23bD--SS niCI the mutant RSS is much weaker than that with the nonmu-
tated RSS. Densitometry revealed an approximately 10-fold
difference in binding signals between the nonmutated and
25
205
mutated probes. Unlike A3- and A10-type clones, the T160
A" type did not show binding with the plasmid probe (pUC18).
C We also examined several other probes for binding. Gener-
ally, base substitutions in the 12-bp RSS probe reduced
binding. However, it was difficult to quantitatively correlate
in vitro binding with in vivo recombination activity. It is
interesting that the 23-bp RSS probe showed weak binding,
indicating that the T160 protein may have some affinities to
B the joining signal(s) even when the spacer length is different
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
hermarnoer n oanarn. (Fig. 1). A bacterial protein of 90 kDa which was used as an
Gr-'AT CCCACAGTGCTCCAGGGCC-A-u ACAA
sAAC
4, -PAT
internal control was not detected with the 23-bp RSS probe
ACAAAAACC3Ak~'T>
or with plasmid DNA. The spacer sequence of this particular
FSS CATCCCAAGTGCTCAGGSTA
nru:ant
CC CACTG T
ATC CCACAGTGGTAGTACT GC A
A C NAAA C
12-bp RSS may be detecting the 90-kDa protein. As will be
23bn- 9$SS G
described below (see Fig. 6C), T160 protein was affinity
CATCCTCAGAGTC GA--I', r t; ,-3 ,7
r ,
p! :. ~
purified with another 12-bp RSS DNA whose spacer se-
FIG. 1. Binding of T160 protein to 32P-labeled DNA probes. (A) quence was different from that of the 12-bp RSS in Fig. 1.
1-Galactosidase fusion proteins were analyzed by Southwestern This is strong evidence to support the idea that the binding of
blotting. Total proteins were extracted from E. coli cells lysogenized T160 with RSS occurred via the joining signal(s) but not via
with phage Xgtll, XT160, or XT140. Proteins were separated on a the spacer sequence. In order to study the binding in a more
7.5% SDS-polyacrylamide gel (31) and then transferred to nitrocel- quantitative manner, we attempted a gel shift assay for both
lulose filters for the binding assay. (B) Four probes were used for fusion proteins and in vitro-translated proteins. Despite
binding. The sequence of the 12-bp RSS probe was taken from the extensive effort, the gel shift assay was not effective for the
mouse VK21-C gene (42). Mutant RSS has a single base substitution at
the third position in the heptamer of the 12-bp RSS. The sequence of T160 protein. Footprint analysis was not successful either.
the 23-bp RSS was taken from the mouse JK1 segment (42). The Nucleotide sequence of T160 cDNA. In order to study the
plasmid sequence was from a polylinker site of pUC18. The mutated sequence characteristics of T160, the cDNA sequence was
nucleotide is indicated by an asterisk. Heptamer and nonamer first determined for the Agtll clone. One long open reading
sequences are underlined. frame, which was also in phase with the lacZ gene, was
found. The cDNA contained coding information for a pep-
tide of 81 kDa, which accounts for the molecular weight of
of these types of clones was avoided by adding excess the ,-galactosidase fusion protein (190 kDa) on the gel (Fig.
amounts of heat-denatured calf thymus DNA in the binding 1A). Figure 2 shows the sequence of 2,569 nucleotides which
solution. Among 14 x 106 cDNA clones screened in the contains the entire coding information for the T160 protein.
presence of calf thymus DNA, 7 clones gave positive signals. The sequence surrounding the putative initiation codon at
Three clones (T140, T156, and T160) remained positive in position 78, AACATGG, matches the initiation signal for the
the second screening. These clones, unlike A3- and A10-type eukaryotic ribosome (28). From the nucleotide sequence, an
clones, did not show binding with the plasmid DNA probe. amino acid sequence of 708 residues was deduced for the
Restriction enzyme analysis and partial DNA sequencing T160 protein. The molecular weight was estimated to be
revealed that T140, T156, and T160 were overlapping cDNA 80,869 Da. In the carboxyl-terminus-proximal region, signif-
clones coding for the same protein. Since clone T160 con- icant homology was noted with the HMG1 protein (22). The
tained the full-length coding region, it was characterized hydrophilic homologous region of 87 residues (HMG box,
further. underlined in Fig. 2) is surrounded by serine-rich and basic
In order to study the DNA binding of T160, the T160-3- amino acid sequences. Serine-rich sequences are found in
galactosidase fusion protein was analyzed by Southwestern several DNA-binding proteins (23, 37, 50). Three serine-rich
blotting (36). Recombinant phage were lysogenized in E. regions were evident around the HMG box in the T160
coli, and synthesis of the fusion protein was induced with protein. They are located at positions 497 to 511 (7 serine
isopropyl-,-D-thiogalactopyranoside. Total proteins of lyso- residues of 14 amino acids), 641 to 673 (16 serines of 33), and
gens were separated by SDS-PAGE and then transferred to 685 to 706 (8 serines of 22). Basic regions were also found in
a nitrocellulose filter. After treatment of this protein with the vicinity of the HMG box. A hydrophilicity profile (Fig.
guanidine HCI, the filter was incubated with the 32P-labeled 3A) shows that the T160 protein is indeed hydrophilic in the
RSS probe. In Fig. 1A, the binding patterns of proteins carboxyl-terminal region. Eight putative glycosylation sites
produced by two clones, T160 and T140, are shown along (Asn-X-Ser/Thr) were found in the deduced amino acid
with a Xgtll control containing no cDNA insert. When the sequence.
12-bp RSS probe was used, both clones T160 and T140 gave Detection of T160 protein with antibodies. Protein was
strong binding signals at positions corresponding to the synthesized from the T160 cDNA in vitro to confirm the
high-molecular-weight fusion proteins. In addition to the open reading frame found in the cDNA sequence. We also
strong signals, faint binding was detected at 90 kDa. This determined the molecular weight of the in vivo protein of
signal was found even in the control and is probably due to T160 in a pre-B-cell line, 38B9. To detect the T160 protein,
nonspecific binding to a bacterial protein. We also tested a guinea pig polyclonal antibodies were prepared by using the
mutated RSS, which contained a single base change at the P-galactosidase fusion protein of T160. Total proteins of
third position in the heptamer (Fig. 1B). Although it is 38B9 were analyzed by Western blotting. As shown in Fig.
difficult to show a qualitative difference in binding in a 4A, the antibodies detected a single band of 86 kDa in theVOL. 11, 1991 HMG1-RELATED DNA-BINDING PROTEIN 4531
ACAGCATCCAGAGAAGGGTTCGTTTTCTCTGGTGCAGCCTAGGGCTGTGTGCTCAGGCCACCACGGGCAGGTGAACATGGCAGAGACATT 90
M A E T L 5
GGAGTTCAACGACATCTTCCAGGAGGTGAAAGGGTCCATGAATGATGGGAGGCTTCGATTGAGCCCGTCAGGTATCATCTTTAAGAACAG 180
E F N D I F Q E V K G S M N D G R L R L S P S G I I F K N S 35
CAAGACGGGCAAAGTGGACAACATCCAGGCTGGGGAGTTGACAGAAGGCATCTGGCCTCGGGTAGCATTAGGCCATGGGCTTAAACTGCT 270
K T G K V D N I Q A G E L T E G I W P R V A L G H G L K L L 65
CACAAAGAATGGGCATGTCTACAAGTACGATGGCTTCCGCGAATCGGAGTTTGAGAAACTCTCTGACTTCTTCAAAACTCACTATCGCCT 360
T K N G H V Y K Y D G F R E S E F E K L S D F F K T H Y R L 95
TGAGCTAATGGAGAAGGATCTGTGTGTGAAGGGCTGGAACTGGGGGACAGTGAAGTTTGGAGGACAGCTGCTTTCTTTTGACATTGGTGA 450
E L M E K D L C V L G W N W G T V K F G G Q L L S F D I G D 125
TCAACCAGTCTTTGAGATACCCCTAAGCAATGTGTCCAGTGTACCACAGGCAAGAATCGAGGTGACCCTGGAATTCCACCAGAATGACGA 540
Q P V F E I P L S N V S S V P Q A R I E V T L E F H Q N D D 155
TCCTGAAGTATCTCTCATGGAGGTGCGCTTCTATGTTCCTCCCACGCAGGAAGATGGTGTGGACCCTGTGGAGGCCTTTGCCCAGAATGT 630
A E V S L M E V R F Y V P P T Q E D G V D P V E A F A Q N V 185
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
TCTGTCAAAGGCAGATGTGATCCAGGCCACCGGAGACGCCATCTGCATCTTCCGGGAGCTGCAGTGTTTGACTCCTCGCGGTCGATACGA 720
L S K A D V I Q A T G D A I C I F R E L Q C L T P R G R Y D 215
TATCCGGATCTACCCTACCTTTCTACACCTGCATGGCAAGACCTTTGACTACAAGATCCCCTATACTACAGTTCTCCGTCTCTTCCTGCT 810
I R I Y P T F L H L H G K T F D Y K I P Y T T V L R L F L L 245
ACCACACAAGGATCAGAGACAGATGTTCTTTGTGATCAGCTTGGATCCTCCCATCAAGCAGGGCCAAACTCGTTACCACTTCCTGATCCT 900
P H K D Q R Q M F F V I S L D P P I K Q G Q T R Y H F L I L 275
CCTCTTCTCCAAGGATGAGGACATCTCCTTGACTCTCAACATGAATGAGGAAGAAGTAGAAAAGCGCTTTGAGGGGCGACTCACCAAGAA 990
L P S K D E D I S L T L N H N E E E V G K R F E G R L T K N 305
CATGTCAGGATCCCTCTATGAAATGGTCAGTCGGGTCATGAAAGCACTTGTCAACCGTAAAATCACAGTCCCAGGCAACTTCCAAGGGCA 1080
M S G S L Y E M V S R V M K A L V N R K I T V P G N F Q G H 335
CTCAGGGGCCCAGTGTATTACCTGCTCCTATAAGGCCAGCTCAGGACTCCTGTACCCACTGGAGCGGGGCTTCATCTACGTGCATAAGCC 1170
S G A Q C I T C S Y K A S S G L L Y P L E R G F I Y V H K P 365
CCCTGTGCACATCCGCTTTGATGAGATCTCTTTTGTCAACTTTGCCCGTGGCACCACGACCACTCGTTCCTTCGACTTTGAGATTGAGAC 1260
P V H I R F D E I S F V N F A R G T T T T R S F D F E I E T 395
CAAGCAAGGCACTCAGTATACCTTCAGCAGCATTGAAAGGGAGGAGTATGGAAAGCTTTTCGATTTTGTCAATGCGAAAAAGCTCAACAT 1350
K N G T N Y T F S S I E R E E Y G K L F D F V N A K K L N I 425
CAAGAACAGAGGACTGAAAGAGGGCATTAACCCAGGCTATGACGATTATGCTGACTCTGATGAAGACCAGCATGATGCCTATTTGGAGAG 1440
K N R G L K E G I N P G Y D D Y A D S D E D Q H D A Y L E R 455
GATGAAGGAGGAGGGCAAGATCCGGGAGGAGAATGCCAATGACAGCAGCGACGACTCAGGAGAAGAGACTGATGAGTCCTTCAATCCTGG 1530
M K E E G K I R E E N A N D S S D D S G E E T D E S F N P G 485
TGAAGAAGAAGAAGATGTGGCAGAGGAGTTTGACAGCAATGCCTCTGCCAGCTCCTCCAGCAATGAGGGTGACAGTGACCGTGAAGAGAA 1620
E E E E D V A E E F D S N A S A S S S S N E G D S D R E E K 515
GAAACGGGAACAGCTCAAAAGGGCTAAGATGGCCAAGGATCGAAAGAGCCGCAGGAAGTCTTCAGAGGCAAAGAAGGGTAAAGATCCAAA 1710
K R E Q L K R A K M A K D R K S R R K S S E A K K G K D P N 545
CGCCCCAAAGAGGCCTATGTCTGCGTACATGCTGTGGCTTAATGCAAGCCGCGAGAAGATCAAGTCGGATCATCCTGGCATCAGTATCAC 1800
A P K R P H S A Y M L W L N A S R E K I K S D H P G I S I T 575
AGATCTTTCCAAGAAGGCAGGGGAGATCTGGAAGGGAATGTCCAAAGAGAAGAAGGAGGAGTGGGACCGCAAGGCTGAGGATGCTAGGAG 1890
D L S K K A G E I W K G H S K E K K E E W D R K A E D A R R 605
GGAGTATGAGAAAGCCATGAAAGAGTATGAAGGAGGAAGAGGGGACTCATCTAAAAGGGACAAGTCTAAGAAGAAAAAGAAAGTAAAAGC 1980
E Y E K A M K E Y E G G R G D S S K R D K S K K K K K V K A 635
AAAGATGGAAAAAAAGTCCACTCCTTCCCGGGGCTCGTCATCCAAGTCTTCATCCAGGCAGTTGAGTGACAGCTTCAAGAGCAAAGAGTT 2070
K H E K K S T P S R G S S S K S S S R Q L S D S F K S K E F 665
TGTGTCCAGTGATGAGAGCTCTTCAGGCGAGAACAAGAGCAAAAAGAAGAGGAGGCGGAGCGAGGACTCTGAAGAGGAGCTAGCCAGTAC 2160
V S S D E S S S G E N X S K K K R R R S E D S E E E L A S T 695
CCCTCCAAGCTCAGAGGACTCTGCCTCGGGATCTGATGAATAAAGGAGGGAATTCCCACCCCGTCACAGCTCCAGTCTCTCACATAGTCC 2250
P P S S E D S A S G S D E *
TTGGATTCTGTGCCATCTGAGTAACTGCTCTTGGTGGCTTCCACTGCCCTGAGGCTTTGAGGGAAGCACCTAACCTCTGCTGCTTTGCAA 2340
GGAAGGCTCCTTGCAATCTGGAGAGAGACTCGGTAGGAGTGTGTTGTCTTCTACTCGCAGTGCATTGTTGGACCCAAGTCCTCAGCCTAC 2430
TTTCCTACTTTCTGACTGTAGTAAAAGCTGCTTCCTGTCCTGTTCAAGTTGCTGCAGCAGGGGTCATGCCAAGTCAGGCCTGTAGCTCCT 2520
AATAGGGGCCTATTTCTACTTTTATTTTGTATTTCTGGTCTGTGAAAAC 2569
FIG. 2. Nucleotide sequence of T160 cDNA and the predicted amino acid sequence. The entire coding sequence for the T160 protein is
shown. A sequence search with the GenBank and National Biomedical Research Foundation data bases showed that T160 has significant
homology to nonhistone chromosomal protein HMG1 (underlined region, residues 538 to 624).
protein extracts of 38B9. Control antibodies for P-galactosi- T3 polymerase and translated with rabbit reticulocyte lysate
dase did not detect any protein bands. The apparent molec- in the presence of [35S]methionine. Translation products
ular weight (86 kDa) was slightly greater than that predicted were precipitated with the T160 antibodies and analyzed by
from the cDNA sequence (80.9 kDa). This may be due to a SDS-PAGE. Two bands were detected by autoradiography
biased distribution of charged amino acids. We also exam- (Fig. 4B). An apparent molecular weight for the larger
ined the apparent molecular weight of the in vitro-synthe- protein was estimated to be 86 kDa, which is the same as that
sized T160 protein. T160 RNA was transcribed with phage estimated for the in vivo protein. An additional band was4532 SHIRAKATA ET AL. MOL. CELL. BIOL.
A T160
5 .0
4.0
a 3.0
.
2.0
.C.
0.
._1 . 0
0.0
2 -1.O
.0 - 2. 0
-3. 0
-4 .0
- 5 .0
100 200 300 400 500 600 700
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
HMG box
I ....
Ser basic basic Ser Ser
B Hydrophilicity
s2. O -
1 .O
T160 * 1. o
-2 .0-_
-3 .0-_
-4 .0-=
538
5.0
3 90
2T0
1 . O-
HMG1 -_1.0 ~
-3 .0-
-4 .0 =
-5 .0
93
Secondary Structure
T 160 S h t i ee
,~~~ l-A--l Turns _ . I
. *
HMG 1 Sheet
FIG. 3. Structural analysis of T160 protein. (A) The hydrophilicity profile was analyzed for T160 with a windowt size of 7. The C-terminal
portion is hydrophilic and contains three serine-rich regions (hatched) and three basic regions (dotted). Between tht two large basic regions,
strong sequence homology with nonhistone chromosomal protein HMG1 (HMG box) was found. (B) Hydrophilicities within the HMG box
are compared for T160 (residues 538 to 642) and calf HMG1 (93 to 177). The two sequences share the same pattern. Predicted secondary
structures are also compared for the HMG boxes of T160 and HMG1. The a-helix, ,-sheet, and p-turn structures were determined by using
the algorithm of Gamier et al. (13).
detected at 79 kDa in the autoradiograph, which could HMG box. In contrast, sequence homology outside the
represent a degradation product of the 86-kDa protein. HMG box is very low in the two proteins. HMG1 has three
HMG box in the T160 protein. As mentioned in the domains named A, B, and C (Glu) (41). The HMG box in
previous section, the T160 protein has a strong homology to T160 corresponds to the second domain (B) of HMG1 (Fig.
HMG1 in the carboxyl-terminal region from residues 538 3B).
through 624. The HMG box corresponds to residues 93 HMG box is a DNA-binding domain. Hydropathy profiles
through 177 in the calf thymus HMG1 (Fig. 5). No gap is (30) were performed for the HMG boxes in T160 and HMG1
needed to maximize the alignment. In this region, almost half (Fig. 3B). The two patterns are very similar and contain two
of the residues (39 of 87) are identical in the two proteins. hydrophobic peaks in the hydrophilic regions. This observa-
When amino acid residues with similar characteristics were tion suggests that the HMG box could be a DNA-binding
counted, the similarity was 56% (49 residues of 87) in the domain in both the T160 and HMG1 proteins. Since HMG1VOL. 11, 1991 HMG1-RELATED DNA-BINDING PROTEIN 4533
A B 35S-labeled translation products were passed through a DNA
affinity column containing the 12-bp RSS. Material retained
38B9 cell Reticulocyte lysate on the column was eluted with high salt concentrations (0.6
O -n M KCl) and separated in a SDS-polyacrylamide gel. Figure
'E
(0 6C shows an autoradiograph of the in vitro-synthesized
T160 RNA + +
proteins bound to the RSS column. Truncated proteins
c c anti-T160 - + - + which deleted the HMG box did not show DNA-binding
activity.
In order to examine the correlation between the exon-
intron structure and the domain structure of T160, genomic
m - 86kd clones for T160 were isolated and analyzed by DNA se-
86kd- - quencing. It was found that the genomic T160 gene con-
tained 17 exons, 15 of which (exons 2 through 16) were for
the coding region (Fig. 7). The HMG box was encoded in
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
two separate exons; one half of the HMG box corresponded
entirely to exon 14, and the other half corresponded to exon
15 (Fig. 5).
Chromosomal location of T160 gene. The chromosomal
location of T160 was determined and compared with other
FIG. 4. Detection of T160 protein. The T160 protein was de-
genetic loci associated with the V-(D)-J joining function. The
tected with guinea pig antibodies in the pre-B-cell extract and in a T160 locus was mapped with a mouse interspecific back-
reticulocyte cell-free system. (A) To detect the natural protein for cross, (BALB/AnPt x Mus spretus) F1 x BALB/AnPt. By
T160, cell extracts from 38B9 (1 ,ug) were separated in a 7.5% analyzing restriction fragment length polymorphisms, the
polyacrylamide gel and transferred to a nitrocellulose filter. Two T160 gene was localized to the proximal end of mouse
kinds of polyclonal antibodies were produced in guinea pigs: one for chromosome 2 (19a). A well-known defect, the CB-17 scid
P-galactosidase and the other for the fusion protein of T160. gene (5), is located on mouse chromosome 16 (6), whereas
Antibody binding was detected with anti-guinea pig immunoglobulin the recombination activator genes RAG-1 (47) and RAG-2
G conjugated with biotin and alkaline phosphatase conjugated with (38) are found on chromosome 2 (19a). The genetic linkage
biotin. On the basis of its electrophoretic mobility in the gel, the between T160 and RAG-1 was studied by using restriction
apparent molecular weight of the T160 protein synthesized in 38B9
was estimated to be 86 kDa. (B) The in vitro product of T160 cDNA fragment length polymorphisms (Fig. 8). To our surprise, no
was detected in the reticulocyte lysate translation system. The recombinants between the two markers (Table 1) were
cDNA was transcribed with T3 polymerase in the presence of detected among 34 backcrossed mice, suggesting that these
[35S]methionine. In vitro-synthesized proteins were immunoprecip- loci are genetically linked. Recently, we analyzed an addi-
itated with the polyclonal antibodies and protein A-agarose beads, tional set of 44 backcross animals, and still no recombinants
and precipitated proteins were separated in a 7.5% SDS-polyacryl- have been found between the genetic loci for T160 and
amide gel. Two positive bands (86 and 79 kDa) were detected. RAG-1 (19a).
DISCUSSION
has been reported to be a cruciform-DNA-binding protein
(3), the HMG box in T160 may also be responsible for DNA In the present report, we describe a DNA-binding protein,
binding. Interestingly, in the T160-type clones isolated with T160, whose DNA-binding domain is related to the HMG
the RSS probe, the HMG box is retained in all cases (Fig. box. A cDNA clone for the T160 protein was isolated from a
6A). The shortest probe-positive clone, XT156, contained Agtll library with a probe containing the RSS for V-(D)-J
only the HMG box followed by the basic and serine-rich joining. In a Southwestern experiment, the T160 protein
regions. Binding experiments with truncated T160 proteins bound to the 12-bp RSS of mouse VK21lC, but it bound very
confirmed the notion that the HMG box is indeed a DNA- weakly, if at all, with a mutant of the heptamer (Fig. 1A).
binding domain. Figure 6B shows four different truncated The protein also bound well to another 12-bp RSS with a
cDNAs made from the clone T160. Truncated proteins were different spacer sequence (Fig. 6C). We therefore assume
synthesized with the in vitro transcription-translation system that the T160 protein specifically interacts with V-(D)-J
as described in the previous section. To detect binding, joining signals. However, neither gel shift nor footprint
EXON 14 EXON 15
v
V
v
~ ~ ~ ~ ~ ~.- --
z z
HH;
-R kGM
ALKN A~Y R A K RP AKA
z1VKA..A TV A A K.R:.. P .-
SKY ?EX~L
al ZJE K..K "D *K.'
.T
Q V
LG P
,t~ P
.,A R,
KAH...~K
UBFl
1
uBn .K
KS D
.I
UBF3 KG GS 2 I
40 60
FIG. 5. Comparison of HMG box sequences. The T160 sequence encoded by exons 14 and 15 (see Fig. 7) is compared with other HMG
box sequences: HMG1 (53), NHP6A (27), SRY (48), al (14), UBF1 to UBF3 (21), and Mc (26). Identical amino acid residues and residues
with similar chemical characteristics (10) are shaded to indicate homology. Arrowheads indicate the boundaries of exons 14 and 15 of the T160
gene.4534 SHIRAKATA ET AL. MOL. CELL. BIOL.
A C
FusO'- ti
Applied 0.6M KCI
c o LO o < it j Q
Lo C
(D(C1as z r(
-- 3Q CC rDa t a N t Lel< c\
1
F--~VOL . 1 l, 1991 HMG1-RELATED DNA-BINDING PROTEIN 4535
TABLE 1. Analysis of recombination frequencies in (BALB/ essential for release from glucose repression encodes a protein
AnPt x M. spretus) F1 x BALB/AnPt mice kinase. Science 233:1175-1180.
9. Davis, M. M. 1985. Molecular genetics of the T cell-receptor
Recombination of locia: beta chain. Annu. Rev. Immunol. 3:537-560.
Breeder No. of 10. Dayhoff, M. O., and R. V. Eck. 1968. The chemical meaning of
RAG-i T160 recombinants patterns in amino acid alleles, p. 43-45. In Atlas of protein
sequence and structure, 1967-1968. National Biomedical Re-
(BALB/AnPt x M spretus) F1 C/S C/S search Foundation, Silver Spring, Md.
F1 x BALB/AnPt C/C C/C 18 11. Desiderio, S., and D. Baltimore. 1984. Double-stranded cleavage
C/S C/S 16 by cell extracts near recombinational signal sequences of immu-
C/C C/S 0 noglobulin genes. Nature (London) 308:860-862.
C/S C/C 0 12. Early, P., H. Huang, M. Davis, K. Calame, and L. Hood. 1980.
a C, BALB/AnPt; S, M. spretus. An immunoglobulin heavy chain variable region gene is gener-
ated from three segments of DNA: VH, D and JH Cell 19:981-
992.
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
13. Garnier, J., D. J. Osguthorpe, and B. Robson. 1978. Analysis of
which is located in the RAG gene locus. Pulsed-field gel the accuracy and implications of simple methods for predicting
electrophoresis and cosmid cloning are now under way to the secondary structure of globular proteins. J. Mol. Biol.
determine the precise distance between the T160 and RAG 120:97-120.
genes. 14. Gubbay, J., J. CoUignon, P. Koopman, B. Capel, A. Economou,
Binding experiments with truncated T160 proteins demon- A. Munsterberg, N. Vivian, P. Goodfellow, and R. Lovel-Badge.
1990. A gene mapping to the sex-determining region of the
strated that the HMG box constitutes the DNA-binding mouse Y chromosome is a member of a novel family of
domain. A similar observation was recently reported for embryonically expressed genes. Nature (London) 346:245-250.
another HMG-related protein, UBF, by Jantzen et al. (21). 15. Gubler, U., and B. J. Hoffman. 1983. A simple and very efficient
Since HMG1 has been reported to be a cruciform-DNA- method for generating cDNA libraries. Gene 25:263-269.
binding protein (3), we tested the T160 protein for its ability 16. Halligan, B. D., and S. V. Desiderio. 1987. Identification of a
to bind cruciform-DNA probes (kindly provided by M. E. DNA binding protein that recognizes the nonamer recombina-
Bianchi). However, the T160 protein did not bind to se- tional signal sequence of immunoglobulin genes. Proc. Natl.
quence-nonspecific cruciform DNA (our unpublished obser- Acad. Sci. USA 84:7019-7023.
vation). We assume that whatever the structure of the 17. Hamaguchi, Y., M. Matsunami, Y. Yamamoto, and T. Honjo.
1989. Purification and characterization of a protein that binds to
recombinase, it should contain DNA-binding components the recombination signal sequence of the immunoglobulin JK
for RSS. Since DNA-binding activity has not been shown for segment. Nucleic Acids Res. 17:9015-9026.
RAG proteins, the T160 protein may well be the RSS-binding 18. Hesse, J. E., M. R. Lieber, K. Mizuuchi, and M. Gellert. 1989.
component of the recombinase. Suppression experiments by V(D)J recombination: a functional definition of the joining
gene targeting or by antisense RNA may give us a clearer signals. Genes Dev. 3:1053-1061.
answer regarding the functional role of T160 for V-(D)-J 19. Hope, T. J., R. J. Aguilera, M. E. Minie, and H. Sakano. 1986.
joining. Endonucleolytic activity that cleaves immunoglobulin recombi-
nation sequences. Science 231:1141-1145.
ACKNOWLEDGMENTS 19a.Huppi, K. Unpublished data.
20. Huynh, T. V., R. A. Young, and R. W. Davis. 1985. Constructing
We are grateful to Richard Maki and Anthony Otsuka for critical and screening cDNA libraries in AgtlO and Agtll, p. 49-78. In D.
reading of the manuscript. We thank C. Michael Samson for M. Glover (ed.), DNA cloning: a practical approach, vol. 1. IRL
technical assistance. Press, Oxford.
This work was supported by grants to H.S. from the National 21. Jantzen, H.-M., A. Admon, S. P. Bell, and R. Tjian. 1990.
Institutes of Health (AI-18790) and the American Cancer Society Nucleolar transcription factor hUBF contains a DNA-binding
(IM-366). motif with homology to HMG proteins. Nature (London) 344:
830-836.
REFERENCES 22. Johns, E. W. (ed.). 1982. The HMG chromosomal proteins.
1. Aguilera, R. J., S. Akira, K. Okazaki, and H. Sakano. 1987. A Academic Press, Inc. (London), Ltd., London.
pre-B cell nuclear protein that specifically interacts with the 23. Kadonaga, J. T., A. J. Courey, J. Ladika, and R. Tjian. 1988.
immunoglobulin V-J recombination sequences. Cell 51:909-917. Distinct regions of Spl modulate DNA binding and transcrip-
2. Akira, S., K. Okazaki, and H. Sakano. 1987. Two pairs of tional activation. Science 242:1566-1570.
recombination signals are sufficient to cause immunoglobulin 24. Kadonaga, J. T., and R. Tjian. 1986. Affinity purification of
V-(D)-J joining. Science 238:1134-1138. sequence-specific DNA binding proteins. Proc. Natl. Acad. Sci.
3. Bianchi, M. E., M. Beltrame, and G. Paonessa. 1989. Specific USA 83:5889-5893.
recognition of cruciform DNA by nuclear protein HMG1. Sci- 25. Kataoka, T., S. Kondo, M. Nishi, M. Kodaira, and T. Honjo.
ence 243:1056-1059. 1984. Isolation and characterization of endonuclease J: a se-
4. Blackwell, T. K., and F. W. Alt. 1984. Site-specific recombina- quence-specific endonuclease cleaving immunoglobulin genes.
tion between IgD and JH segments that were introduced into the Nucleic Acids Res. 12:5995-6010.
genome of a murine pre-B cell line. Cell 37:105-112. 26. Kelly, M., J. Burke, M. Smith, A. Klar, and D. Beach. 1988.
5. Bosma, G. C., R. P. Custer, and M. J. Bosma. 1983. A severe Four mating-type genes control sexual differentiation in the
combined immunodeficiency mutation in the mouse. Nature fission yeast. EMBO J. 7:1537-1547.
(London) 301:527-530. 27. Kolodrubetz, D., and A. Burgum. 1990. Duplicated NHP6 genes
6. Bosma, G. C., M. T. Davisson, N. R. Ruetsch, H. 0. Sweet, L. D. of Saccharomyces cerevisiae encode proteins homologous to
Shultz, and M. J. Bosma. 1989. The mouse mutation severe bovine high mobility group protein 1. J. Biol. Chem. 265:3234-
combined immune deficiency (scid) is on chromosome 16. 3239.
Immunogenetics 29:54-57. 28. Kozak, M. 1986. Point mutations define a sequence flanking the
7. Bradford, M. M. 1976. A rapid and sensitive method for the AUG initiator codon that modulates translation by eukaryotic
quantitation of microgram quantities of protein utilizing the ribosomes. Cell 44:283-292.
principle of protein-dye binding. Anal. Biochem. 72:248-254. 29. Kronenberg, M., G. Siu, L. Hood, and N. Shastri. 1986. The
8. Celenza, J. L., and M. Carlson. 1986. A yeast gene that is molecular genetics of the T-cell antigen receptor and T-cell4536 SHIRAKATA ET AL. MOL. CELL. BIOL.
antigen recognition. Annu. Rev. Immunol. 4:529-591. 42. Sakano, H., K. Huppi, G. Heinrich, and S. Tonegawa. 1979.
30. Kyte, J., and R. F. Doolittle. 1982. A simple method for Sequences at the somatic recombination sites of immunoglobu-
displaying the hydropathic character of a protein. J. Mol. Biol. lin light-chain genes. Nature (London) 280:288-294.
157:105-132. 43. Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, and S. Tone-
31. Laemmli, U. K. 1970. Cleavage of structural proteins during the gawa. 1980. Two types of somatic recombination are necessary
assembly of the head of bacteriophage T4. Nature (London) for the generation of complete immunoglobulin heavy-chain
227:680-685. genes. Nature (London) 286:676-683.
32. Li, M., E. Morzycka-Wroblewska, and S. V. Desiderio. 1989. 44. Sakano, H., Y. Kurosawa, M. Weigert, and S. Tonegawa. 1981.
NBP, a protein that specifically binds an enhancer of immuno- Identification and nucleotide sequence of a diversity DNA
globulin gene rearrangement: purification and characterization. segment (D) of immunoglobulin heavy-chain genes. Nature
Genes Dev. 3:1801-1813. (London) 290:562-565.
33. Lieber, M. R., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, 45. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-
K. Mizuuchi, M. J. Bosma, and M. Gellert. 1988. The defect in ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.
murine severe combined immune deficiency: joining of signal USA 74:5463-5467.
sequences but not coding segments in V(D)J recombination.
Downloaded from http://mcb.asm.org/ on December 30, 2020 by guest
Cell 55:7-16. 46. Shatz, D. G., and D. Baltimore. 1988. Stable expression of
34. Matsunami, N., Y. Hamaguchi, Y. Yamamoto, K. Kuze, K. immunoglobulin gene V(D)J recombinase activity by gene trans-
Kangawa, H. Matsuo, M. Kawaichi, and T. Honjo. 1989. A fer into 3T3 fibroblasts. Cell 53:107-115.
protein binding to the JK recombination sequence of immuno- 47. Shatz, D. G., M. A. Oettinger, and D. Baltimore. 1989. The
globulin genes contains a sequence related to the integrase V(D)J recombination activating gene, RAG-1. Cell 59:1035-
motif. Nature (London) 342:934-937. 1048.
35. Max, E. E., J. G. Seidman, and P. Leder. 1979. Sequences of 48. Sinclair, A. H., P. Berta, M. S. Palmer, J. R. Hawkins, B. L.
five potential recombination sites encoded close to an immuno- Griffiths, M. J. Smith, J. W. Foster, A.-M. Frischauf, R.
globulin kappa constant region gene. Proc. Natl. Acad. Sci. Lovell-Badge, and P. N. Goodfellow. 1990. A gene from the
USA 76:3450-3454. human sex-determining region encodes a protein with homology
36. Miskimins, W. K., M. P. Roberts, A. McClelland, and F. H. to a conserved DNA-binding motif. Nature (London) 346:240-
Ruddle. 1985. Use of a protein-blotting procedure and a specific 244.
DNA probe to identify nuclear proteins that recognize the 49. Singh, H., J. H. LeBowitz, A. S. Baldwin, Jr., and P. A. Sharp.
promoter region of the transferrin receptor gene. Proc. Natl. 1988. Molecular cloning of an enhancer binding protein: isola-
Acad. Sci. USA 82:6741-6744. tion by screening of an expression library with a recognition site
37. Miyamoto, M., T. Fujita, Y. Kimura, M. Maruyama, H. Harada, DNA. Cell 52:415-423.
Y. Sudou, T. Miyata, and T. Taniguchi. 1988. Regulated expres- 50. Sturm, R. A., G. Das, and W. Herr. 1988. The ubiquitous
sion of a gene encoding a nuclear factor, IRF-1, that specifically octamer-binding protein Oct-1 contains a POU domain with a
binds to IFN-P gene regulatory elements. Cell 54:903-913. homeo box subdomain. Genes Dev. 2:1582-1599.
38. Oettinger, M. R., D. G. Schatz, C. Gorka, and D. Baltimore. 51. Tonegawa, S. 1983. Somatic generation of antibody diversity.
1990. RAG-1 and RAG-2, adjacent genes that synergistically Nature (London) 302:575-581.
activate V(D)J recombination. Science 248:1517-1523. 52. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic
39. Okazaki, K., S. Nishikawa, and H. Sakano. 1988. Aberrant transfer of proteins from polyacrylamide gels to nitrocellulose
immunoglobulin gene rearrangement in scid mouse bone mar- sheets: procedure and some applications. Proc. Natl. Acad. Sci.
row cells. J. Immunol. 141:1348-1352. USA 76:4350-4354.
40. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for 53. Walker, J. M., K. Gooderham, J. R. B. Hastings, E. Mayes, and
biological sequence comparison. Proc. Natl. Acad. Sci. USA E. W. Johns. 1980. The primary structures of non-histone
85:2444 2448. chromosomal proteins HMG1 and 2. FEBS Lett. 122:264-270.
41. Reek, G. R., P. J. Isackson, and D. C. Teller. 1982. Domain 54. Wang, J. C., P. R. Caron, and R. A. Kim. 1990. The role of
structure in high molecular weight high mobility group nonhis- DNA topoisomerases in recombination and genome stability: a
tone chromatin proteins. Nature (London) 300:76-78. double-edged sword? Cell 62:403-406.You can also read
