Embryonal Long Terminal Repeat-Binding Protein Is a Murine Homolog of FTZ-F1, a Member of the Steroid Receptor Superfamily
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
MOLECULAR AND CELLULAR BIOLOGY, Mar. 1992, p. 1286-1291 Vol. 12, No. 3
0270-7306/92/031286-06$02.00/0
Copyright © 1992, American Society for Microbiology
Embryonal Long Terminal Repeat-Binding Protein Is a Murine
Homolog of FTZ-F1, a Member of the Steroid Receptor Superfamily
TOSHIO TSUKIYAMA,' HITOSHI UEDA,2 SUSUMU HIROSE,3 AND OHTSURA NIWAl*
Department of Pathology, Research Institute for Nuclear Medicine and Biology, Hiroshima University,
Minami-ku, Hiroshima 734,1 and Genetic Stock Research Center2 and DI A Research Center,
National Institute of Genetics, Mishima 411, Japan
Received 22 October 1991/Accepted 4 December 1991
The embryonal long terminal repeat-binding protein, ELP, is present in undifferentiated mouse embryonal
Downloaded from http://mcb.asm.org/ on May 11, 2021 by guest
carcinoma cells. It binds to and suppresses transcription of the Moloney leukemia virus long terminal repeat
in undifferentiated murine embryonal carcinoma cells. We report here that ELP is a mouse homolog of
Drosophila FTZ-F1, which positively regulates transcription of the fushi tarazu gene in blastoderm-stage
embryos of the fly. As members of the steroid receptor superfamily, ELP and FTZ-Fl have both DNA binding
and putative ligand binding domains which are well conserved between the two. ELP and FTZ-F1 function in
cells in the extremely early stage of development. A high degree of conservation between the two transcription
factors during the evolution of these species indicates the importance of their functions in early-stage
embryogenesis. In addition, the sequence elements they recognize do not contain repeat units, in contrast to
other steroid receptors, which usually bind to either palindromic or direct repeat sequences.
Stem cells of early-stage mammalian embryos are unique we have succeeded in cloning the cDNA coding for ELP.
in that they are totipotent in their capacity for differentiation. Analysis of the cDNA indicated that ELP is indeed a mouse
Tissue-specific genes are repressed tightly in these cells. homolog of FTZ-F1.
Tissue-specific activation of genes takes place only after
implantation of embryos. In addition to these genes, many
viral genomes are also repressed in the stem cells of the MATERIALS AND METHODS
preimplantation-stage embryos as well as in undifferentiated Cell cultures. Cells used in this study were described
embryonal carcinoma cells (EC cells). Analysis of host range previously (31). All the cell lines were maintained in minimal
mutations in polyomavirus revealed the complex nature of essential medium alpha (Irvine Scientific, Santa Ana, Calif.)
the repression (17). supplemented with 8% fetal calf serum.
Retroviruses are also the targets of repression in EC cells Differentiation of ECA2 cells, a subline of PCC4 EC cells,
(5, 19, 28). The mechanism of the repression of Moloney was induced by addition of all-trans retinoic acid (Sigma
murine leukemia virus (Mo-MuLV) has been the subject of Chemical Co., St. Louis, Mo.) to 10-6 M in growth medium.
intensive studies, and at least three mechanisms were shown Gel retardation assay. Preparation of the nuclear extracts
to be responsible for the repression. The amount and number
of activator proteins which bind the enhancer region of the from ECA2 cells (31), Drosophila embryos (36), and the silk
long terminal repeat (LTR) are low in undifferentiated EC gland of Bombyx mon (34) were as described previously. For
cells (27). This repression can be circumvented by the in vitro translation of cloned ELP cDNA, RNA was tran-
insertion of an active enhancer in the LTR (13). It is also scribed by T7 RNA polymerase from pBS-ELP, in which the
abrogated by a mutation which creates an Spl binding site in open reading frame of the ELP cDNA was placed down-
the enhancer region (9). The 5' noncoding region of the viral stream of the T7 promoter. RNA was then translated in
genome functions as a negative element in EC cells (14, 32). rabbit reticulocyte lysate according to the manufacturer's
The host range mutants of Mo-MuLV which can replicate in recommendation (Promega Co., Madison, Wis.).
EC cells carry mutations in this region (38). In addition, we The binding sites for ELP and FTZ-F1 were used as
have previously identified an embryonal LTR-binding pro- probes for the gel retardation assay. These sequences were
tein, ELP, which binds to and represses the LTR in undif- terminally labeled to a specific activity of approximately 8 x
ferentiated EC cells (31). A 10-fold decrease in the transcrip- 103 cpm/fmol. A 2-fmol sample of the probe was used for
tion was noted in ECA2 cells, a PCC4-derived subline of EC each lane. As for the competition assay, 40 fmol of the
cells, when the ELP binding element was placed upstream of competitor was added to the reaction mixture. The proce-
the enhancer of the LTR (33). Again, a mutation at the ELP dure for the gel retardation assays was as described previ-
site in a host range mutant of Mo-MuLV was reported, ously (35).
indicating the importance of the ELP element in repression Chloramphenicol acetyltransferase (CAT) assay. NIH 3T3
of Mo-MuLV in EC cells (10). cells in 60-mm dishes were transfected with 0.5 ,ug of
During the attempts to clone the cDNA of ELP, a report in reporter plasmids, 5 p.g of effector plasmids, 2 pg of pact-a-
which a Drosophila transcription factor, FTZ-F1, was gal and 2.5 ,ug of pUC119. Transfection was done by the
shown to bind to the same sequence element as ELP CaPO4 method, and the details of the procedure are as
appeared (36). Using the cDNA of FTZ-F1 as a probe (12), described previously (31). Experiments were repeated at
least five times, and the data shown in the figures are those
for the typical cases.
pRV-ELP was constructed by inserting ELP cDNA in
*
Corresponding author. expression vector pRVSVneo (24), containing the Rous
1286VOL. 12, 1992 CLONING OF LTR REPRESSOR IN EC CELLS 1287
A
Probe EI__ a i Lt i"I7-F1 sitel
t I
B l{} Vi lr
t rarls ai d
Competitor lBiFFIZ-FI FLP i- I'
Extract
/
.' si te 5'-GCAGCACCGTC'ICAAGGTCGCCGAGTAGGAGAA-3' Y , 0
-VD------------
f tz2NEI
f tzlT VI)--- -- --
S0
ftzIE --_-_______R --------------------- S:
4
0
9
a
f tzlG
f tz8A
-----------C------T S
0 FTz-FI --------------
f tz9T
~~
f tz3L ---- --- ---C ---H---A------
-------------A------------------
- S 4'
0
~~BmFTZ-Fl
ft 7zfE -
H R
.0 0 FLIX
ftz5-15
.I
f t.uJ.
-------
f ti9E
----- Y----- 4'
mu~~~~.
9
Downloaded from http://mcb.asm.org/ on May 11, 2021 by guest
ftzNtI 1 DDY-
ftz3NE2
FIG. 1. (A) Gel retardation analysis of ELP, FTZ-F1, BmFTZ-F1, and in vitro-translated protein products of the ELP cDNA. Probes used
are the recognition sites for ELP (ELP site) and FTZ-F1 (FTZ-F1 site I). The complexes are indicated by arrows. Nuclear extracts from ECA2
cells, Drosophila embryos, and the silk glands of B. mon were used as sources of ELP, FTZ-F1, and BmFTZ-F1, respectively. t.1. + and
t.1.-, in vitro-translated protein products with and without RNA transcripts of the ELP cDNA, respectively. (B) Comparison of the
specificity of sequence recognition of ELP, BmFTZ-F1, and the in vitro translated protein product. Only the bands corresponding to the
complexes are shown. The FTZ-F1 site I sequence was used as a probe. The mutated site I sequences were used as competitors and added
at a 20-fold excess in the binding reaction mixture. The nucleotide sequences are depicted under the wild-type sequence. Letters denote
mixtures of nucleotides: Y, T+C; R, G+A; D, G+A+T; V, G+A+C; B, G+T+C; H, A+T+C.
sarcoma virus (RSV) LTR and the poly(A)+ signal of simian Nucleotide sequence accession number. The nucleotide
virus 40. As for the negative control, a stop codon linker sequence data reported in this paper will appear in the
(New England Biolabs Inc., Beverly, Mass.) was inserted DDBJ, EMBL, and GenBank nucleotide sequence data
between PmaCI sites in the zinc finger region of ELP in bases under accession no. D90530.
pRV-ELP, and the resulting plasmid was designated pRV-
ELP-ZFS. pMolPKCAT has the enhancer and promoter RESULTS
regions of Mo-MuLV LTR upstream of the CAT gene, and
pSP8PKCAT carries eight copies of ELP binding sites Binding specificity of ELP and FIZ-Fl. In our previous
upstream of the enhancer region of pMolPKCAT in the same study, ELP was shown to be present specifically in various
orientation as in the original ELP site (31). undifferentiated EC cells of mouse and human origin. The
The amounts of cell extracts for the CAT assay were amount of ELP was especially high in ECA2 cells, a subline
normalized by the level of 13-galactosidase activity. Prepara- of PCC4 cells (31). ELP binds to the sequence element
tion of cell extracts and assay procedures were as described TCAAGGTCA, which is located 12 bp upstream of the
previously (7, 33). enhancer of Mo-MuLV LTR (31). FTZ-F1 is involved in
cDNA cloning and sequencing. A randomly primed cDNA activation of the fushi tarazu gene in early-stage Drosophila
library of undifferentiated ECA2 cells was constructed on embryos by binding to the sequence element YCAAGGYCR
Agtll and screened by plaque hybridization probed by' the in the Zebra element of the gene (36). This sequence com-
zinc finger region of FTZ-F1. The filters were washed in 2x pletely matches that of the ELP element, suggesting that
SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate)- ELP may have similarity to FTZ-F1.
0.5% sodium dodecyl sulfate (SDS) at 65°C for 60 min. The ELP element and site I, one of the FTZ-F1 elements,
DNAs from positive clones were subcloned into pUC119 and were tested for interaction with FTZ-F1, BmFTZ-F1 (the'B.
sequenced by the dideoxy chain termination method (25). mon homolog of FTZ-F1 [34]), and ELP. BmFTZ-Fl has the
Production of anti-ELP antibody. A DNA fragment of the same sequence specificity as FTZ-F1 (35). As is clear from
ELP cDNA from AvaIII to PmaCI (207 to 572 nucleotides), Fig. 1A, ELP, FTZ-F1, and BmFTZ-F1 each bound to both
encoding amino acids 4 to 126 of the ELP protein, was of the elements. Although specific activities of the probes
cloned into bacterial expression vector pET3a (22). The were similar, site I of the FTZ-F1 binding element always
protein product of the cDNA was extracted from Esche- gave stronger bands than did the ELP site. This suggests that
richia coli,. purified by SDS-polyacrylamide gel electropho- site I of FTZ-F1 may have a higher affinity for all three
resis, and recovered by electroelution. A New Zealand factors. We then tested by competition assay the specificity
White rabbit was injected subcutaneously with 100 ,ug of the of the binding of ELP and BmFTZ-Fl to site I carrying a
protein product together with Freund's complete adjuvant series of mutations. The patterns of competition were iden-
(Difco Laboratories, Detroit, Mich.). Rabbits were boosted tical between the two factors (Fig. 1B). This indicates that
three times with 50 ,ug of the protein at intervals of 2 weeks. ELP and FTZ-F1 are related and may have sequence homol-
Northern analysis. Total cellular RNA was prepared by ogy in the DNA binding domain.
sedimentation through cesium chloride (3), electrophoresed, Cloning of the mouse homolog of FIZ-Fl. The zinc finger
and blotted onto membrane filters which were then hybrid- region of the FTZ-F1 cDNA (21) was used as a probe to
ized as described previously (16). For the blotting, 30 ,ug of screen the phage library of undifferentiated ECA2 cells, and
total RNA was loaded onto each lane. Filters were washed one of the isolates contained a complete open reading frame.
with O.lx SSC-0.5% SDS at 65°C. In order to confirm that this corresponds to that of ELP, an1288 TSUKIYAMA ET AL. MOL. CELL. BIOL.
5-ooA!iCCCC:CTCCOTToOCC 20
Mo-MuLV
AOTACTOOCTOOAO!CTCTOTCTCTTCTAOACTCTCTOCCTCA0OTCTCTOTCOOOOCCC 80
CCAGAACAA!CCAOCTOTOTOCCCSACTTCOCCCTOOTCCCTOOCOTCTOTCTTOCCCO
COTCCOAGCCTATCTOATTTTCTCAOAATCOOOOTTTTOTTCTCAOACAAACOAATCTOO
140
200
probe site I promoter
0 0
ATOO&AATOCATCOAATCCOAOOOTCCCOOATCOOOCOCOOCAOAOOCO.COAOOAAOCA 260
NetOluNet3iuArgIloArgolyberArgleOlyAr,O1yArOly,loyluOlual. 20
OCCCTGGAACCCGOTSGCTOCTOCAsCOCAOACATCOCCCACaaACCCccoc 320
0
AlaLeuOluArgfly@lyTrpLeuserCyggeralaslyThrTrpproThrau.ProArg 40
serum
- 4
ACCCooCCCoGoCTso@oACCGCCCCOTGTOCACAGACC&oGGCAATCCCAAGCCAoTCo 380
bhrArgProOlyLeuglyThrAlaProCyAlaOlTbhrArgAal.lorro..r.la..r 60
CCOTC00CCCOCOCTOACCCGATCCTCCTTCCACAOOC0OACOCCOCOOOCATOOACTAc
ProSer&laArgAlaAspproz
440
leLuLeouProolmAlaAspAlaAlaolyMNtagpTyr so *CBP
TCOTACOACOAOOACCTOOACOAOCT OTCCAOTOTOTOOTOACAAOOTOTCOOCTAC 500
8GrTyrAspOluAspL*uAspOluLe yuProValCyuOlyaupLysVal.rolyTJy 100
CTACCOOOCTOCST_COTOCOkOAOCTOCAAOOOCTTCTTCAAOCOCACAG!CCAOAAc 560
iasyrOlyLeuLSuThrCyuOluSerCy.Ly.Olrph.phbLy,ArgThrYVaI0As 120 ELP* i
I AACAAOCATTAtACOTOCACCOAOATCAAOGOCTOCAAAATCOACAkOACOCCOCOTAA 620
AsmLysEiuTyrThrCysThrOluuerOla.srCysLyUIl1AspLy,ThrOlmArgLy 140
OCTOTCCCTTCTGCCOCTTCCAGAAGTOCCTOACOOTOOOCATOCOCCTGGA CTSTO 680
rgCyuProFrhCymArgPheolaLy.CyaL.uThrVally-t7ArSL..l laval 160
Downloaded from http://mcb.asm.org/ on May 11, 2021 by guest
COTOCTOATCOAATGCGOOOGTGCCOOAACAAGTTTGOOCCCATOTACAAOAGAGACCOO 740
ArgAlaA pArgNtArg0glyglyAr;ganLyspb.OlyProM.tTyrLysuargApArg 180
OCCTTGAA0C&CAOCAAGAAAGCACAGATVC@G@CCAATOOCTTCK&&CTOG&GACCOOA mW
AlaLeuLyaOlaglaLyuLyaAlaOlllArgAlaAUn.lyPh.Ly.L.ouluThrOly 200
CCACCOATGOGOOTOCCCCCTCCACCCCCTCCCCCACCOOACTACATOTTACCCCCTAOC
ProProNetOlyValProProProproProProProProA.pTyrM.tL
860
FuProProF
-r 220
CTOCACOCACCOOAOCCCAAOOCCCTOOTCTCTOOCCCACCCAOTGOOCCOCT.O.TOAC 920
FIG. 3. Suppression of the binding of ELP by anti-ELP anti-
LeuNEiAlarroOlurroLyuAlaL*uValg.rGlyProrro.rOl.ProLuGOlyAop 240
ATTOOACCCCCATCTCTACCCATOTCTOTGCCTGOTCCCCACOGACCTCTOOCTOOCTAC 980 body. The preimmune serum and antiserum were tested by gel
lleGlyAlaProUerLeuProNetgerValProglyproNisglyProLouAla6lyTyr 260 retardation assay with nuclear extract of ECA2 cells. The probes
CSCTATCCTOCCTTCTCTAACCOCACCATCAAOTCVG&OTkTCCAOAGCCCT&TOCCAOC 1040 used were the site I sequence and the promoter region (XbaI to
LouTyrProklaPhe*er&asArgTh?ll-LJaU.roluTyrproluPro.yrAlal r 280
KpnI) of the Mo-MuLV LTR. CBP, CCAAT box-binding protein
CCCCCACAACAoCCAGoOCCACCCTACAOCTATCCAGAOCCCTTCTCAOAGOoCCCAAT
rrqProgluglnrroglyrroProTyrg.rTyrpro0luProFbr.SrOlyOlyProAn
1100
300
(31). Undiluted serum (1 ,ul) was added to 20 p.l of the binding
mixture simultaneously with nuclear extracts and incubated for 30
OTACCAGAOCTCATATTOCAGCTGCTGCAJCTA@AOCCAA6GAOGOACCAGOTOCOCOCT 1160
min at room temperature before application to the gel.
ValProgluL-ull-eLeuOlaLouL*uglmOluProOluOluAsp_lAValArgAla 320
CoCATCOTGooCTGoCToCA@AOACCAGCCAAAACCOOCTCTsoACCAoCCACOCCCTTC
. ~ _ _ j.*ra_ pUmA ____ _.
o_ 1220
I
340
AOCCTCCT OCAOAATGOCCOACCAGACCTTTATCTCCATTOTCOACTO6OCACOAAO
lerLeuLv CyArgMNtAlaASpOlmThrPbel-SeerlleValAspTrpAlaAr
1280
reading frame which had a coding capacity for a polypeptide
360
GOCAT@OTCTTTAAOGAOCTOAOTASGGCTOACCAGATGACACTGCTCAGAACTOTTOG 1340
of 465 amino acids. The molecular mass of the cDNA
CI M*tVaIVhbLy oluL-uoluyalAlaA.p0l MetThrLouLuOl.AsnCys
Tr 380 product was calculated to be 51.3 kDa. The polypeptide has
6CoAoCT@CTGoGTQT ACCACATCTACCoCCAAGTCCAOTACoOCAAcoAAGACAGC 1400 a typical structure of nuclear hormone receptors (2). The
*rgluLeuLeuValL. spPluIleTyrArgOlmValo1uTyralyLyuoluAsp8.r 400
DNA binding domain (region I, boxed in Fig. 2) consisted of
ATCCTOCTOOTTAOTO0ACAO0AGOTAACTOAACTG0XAAACCCCTAOTCCTOCATAAT 1460
two zinc finger motifs, and the domain involved in putative
Il*LeuLeuValSerOlyGlnOluValThrOluL.uValLysProL.uValL ouEiAsa 420
CCCAGOCCTCTCAG@OCTOACTCOGOACACCCCAAATTCCAAATTCAGOGACATOCACTA
ProArgProLeuArgAlaAupSerOly.llProLy.Ph-Olull-OIGlylI,EAlaL-u
1520
4O
ligand binding and dimer formation was located in the
OCCAOGCTTCTCTGTOTCCTOGOOCCATTTOAGAOACCACASOTGTOAA,GGTCAOTGOA 1580
C-terminal half.
AlaArgLeuLouCyaValLeuOlyProPheoluoluProOl.Cya.lyXdtValSar0ly 460 Inhibition of ELP binding by the antibody against the cDNA
AOTTCTTATAGOA@ATAACATOGOAATTOGATCTCCCCAAAATAAGOCAGAOTTGOTCAO
Serfer!yrArgArg***
1640 product. The 5' region of the cDNA was cloned into an
465
expression vector, and the polypeptide spanning the N-ter-
CVsOTACToAAGToACAOETGOCCAoTCTATOCToTCACACATTOoATGCToCAoOATCT 1700 minal portion to the first zinc finger of the putative ELP was
A0OACTCAOAOAAGOGATTCOOAATAGGOCCAAGGAACTOTOOOOSOOCAAOGTTAA.AO
AT@AO@TTOCAGOCATTOCTAAOGCTSOOTGAOCAGOT@AGACCCTOTAOGTCTCCATTC
1760
1820 produced in E. coli. Gel-purified protein was used to raise
TCATAAATOATOAATOAATAAATOAATOAACOAATGAACOAAOOAACACAAOAOTOOCO
AAAAG*AAAGAGAOACTCAOACTCA@AATTTOoCCCTTTTAGATCAGAGAATOTATTACOG
1880
1940 antibody in rabbits. The antibody was tested by gel retarda-
O@TO@GAAGTCATTAOGAAOGCCTGGAAACTCCTOAACTCCACCTCCACCCACAOOAaGa 2000 tion assay. As is clear in Fig. 3, the antibody blocked the
ACATTAGOOTTCCTAGTOGATOTGOOTOKAGvAOCCTAAATOTCTOGOOTTTOACACCAT 2060
TTAAAGA0-32 2068 formation of the ELP complex with the site I element. This
FIG. 2. Nucleotide and amino acid sequences of the ELP cDNA, indicates that the antibody raised against the protein product
numbered on the right. Boxed areas are the zinc finger region (I) and of the cDNA cross-reacted with ELP in a crude nuclear
the putative ligand-binding domain (II). Asterisks and underlines in extract of ECA2 cells. The more slowly migrating band
box I indicate the PmaCI sites, between which a stop codon was appearing after treatment with the antibody may be the
inserted in the negative control plasmid used for the CAT assay. tripartite complex of the antibody, ELP, and the probe. The
antibody had no effect on the formation of the complex with
the promoter region of the Mo-MuLV LTR (nucleotides
in vitro protein product was made from the transcript of the -150 to + 31). The complex on this fragment was previously
cDNA and used for the gel retardation assay. Figure 1A shown to be due to the CCAAT box-binding protein in ECA2
shows that the in vitro product bound to the ELP site as well cells (31). This confirms the specificity of the antibody.
as to site I. The mobility of the complex with the in vitro These results clearly demonstrate that the cDNA does code
product was slightly lower than that with ELP, and the for ELP.
reason for this is presently unknown. Nevertheless, the Functional analysis of the cDNA product. Figure 4A shows
results strongly suggest that the cDNA indeed codes for the construction of the reporter plasmids used in the func-
ELP. Further confirmation was made by analyzing the tional assay of ELP. The ELP cDNA was cloned into a
specificity of the binding. Affinity of the in vitro product for mammalian expression vector and tested in NIH 3T3 cells,
the mutant sequences was identical to that of ELP and which completely lacked endogenous ELP activity (31). The
BmFTZ-Fl (Fig. 1B). efficiency of transfection was normalized by the level of
Sequence of the cDNA. The cDNA was sequenced, and the P-galactosidase activity driven by the 1-actin promoter. The
result is shown in Fig. 2. The cDNA carried an intact open ELP expression plasmid contained the 2,068-bp fragment ofVOL. 12, 1992 CLONING OF LTR REPRESSOR IN EC CELLS 1289
A B
ELP 6C rlch TATA CrAAT Reporter pRSVCAT pMoLPKCAT pSP8PKCAT
sSte enharce r reg i on box box tl
v v * v r
AC% 35.4 49.1 43.3 19.3 23.8 5.7
Sau5AI PvuII Xmal Kcnl
(-135) ( -3728 ( -A50)
_
K( I5 99 .
P1CUCAT -
CAT
* * *
OSPSPKCA7
ELP
Downloaded from http://mcb.asm.org/ on May 11, 2021 by guest
FIG. 4. Suppression of LTR-driven transcription by forced expression of the cloned ELP cDNA in fibroblasts (14). (A) Constructs of
effector plasmids. Eight copies of the Sau3AI (-353) to PvuII (-328) fragment of the LTR were ligated in a head-to-tail orientation. They were
placed upstream of the enhancer of pMolPKCAT to make pSP8PKCAT (31). (B) CAT assay. ELP + and -, cotransfection with ELP
expression vector, pRV-ELP, and negative control vector, pRV-ELP-ZFS, respectively. AC%, percentage of acetylated chloramphenicol in
each assay.
the ELP cDNA placed between the RSV LTR and the Expression of ELP mRNA. Expression of ELP mRNA was
poly(A)+ signal of simian virus 40. The negative control analyzed during retinoid-induced differentiation of ECA2
plasmid was constructed in a similar fashion, except that the cells. As shown in Fig. 5A, expression of ELP decreased
cDNA had a stop codon at the zinc finger region of the until no mRNA was detected at 2 days after the induction.
cDNA. Experiments were repeated five times, and cotrans- This indicates that expression of ELP is specific in undiffer-
fection of the ELP construct reproducibly suppressed the entiated EC cells and is consistent with the result of the gel
CAT activity driven by the LTR containing eight copies of retardation analysis in which the ELP complex completely
the ELP element by approximately fourfold (Fig. 4B). This disappeared in ECA2 cells treated with retinoid for 2 days
suppression was dependent on the amount of the ELP (33).
plasmid applied on the cells (data not shown). A low degree As shown in Fig. 5B, ELP mRNA was detected in all of
of suppression (around twofold) was repeatedly observed for the mouse EC cell lines but not in fibroblastic lines. This was
pMolPKCAT, which lacked the ELP site. This may be due again consistent with the result of the gel retardation assay
to the cryptic ELP target site present in the enhancer region (31). The apparent lack of ELP mRNA in a human EC line,
(30a). Transcription from the RSV LTR, which has no ELP NEC8, may be due to a low level of expression in this cell
site, was not suppressed by the ELP plasmid. These results line (31) and/or to divergence in the nucleic acid sequences
demonstrate the specificity of the suppression by ELP and of humans and mice.
confirm that the cDNA carries the coding region of function- Sequence comparison of ELP with other nuclear hormone
ally intact ELP. receptors. Figure 6 compares the amino acid sequence of
A B 11
I I \
,-\ a,
I '14,-
RA treatment Th~N *X>-~ Cell linres \ .. \.-
928S *28S
Bass U.
*18S *18S
n-act lfn
n-actin _w
ww~Iw w
,mw 1w
FIG. 5. (A) Expression of ELP during differentiation of ECA2 cells. The numbers above the gel indicate the time atter induction of
differentiation by retinoic acid. A 1-actin probe was used as a control for the amount of RNA analyzed. (B) Expression of ELP in various
cell lines. ECA2, PCC4, PCC3, and F9 cells are mouse EC cells. NEC8 cells are human EC cells. Ltk- and NIH3T3 cells are mouse
fibroblasts.1290 TSUKIYAMA ET AL. MOL. CELL. BIOL.
Zn finger region 11 specificity of binding was shown to be the same for ELP,
8*5 FTZ-F1, and the in vitro translation product of the cDNA. In
ELP C~~~~~ I
addition, antibody raised against the N-terminal portion of the
FTZ-F1
88e.8 55.82
cDNA product specifically inhibited the formation of ELP
521 complex when tested by gel retardation assay. These results
ERRI firmly demonstrated that ELP is a mouse homolog of FTZ-F1,
60.92 37.22
862 which is a member of the steroid receptor superfamily.
hRAR ELP and FTZ-F1 are unique among nuclear hormone
58.02 30.22
receptors in that their binding elements do not contain repeat
ERR2 I
58.02
_
39.72
_ t33 units, which are common among elements for other recep-
823 tors (11). Another feature common to ELP and FTZ-F1 is
COUP-TF(EAR3)
56.52 88.22 _ the developmental stages during which they are expressed.
h6R ELP is expressed in EC cells, which are derived from cells in
56.52 38.92 the blastocyst stage (31), while FTZ-F1 is derived from cells
EAR2 853
in the blastoderm stage (36). Mice and fruit flies belong to
55.1X M.=Z
Downloaded from http://mcb.asm.org/ on May 11, 2021 by guest
entirely different phyla and have completely different pat-
hTR 30.2Z terns of embryonic development. The fact that both ELP and
FTZ-F1 are expressed during early-stage embryogenesis is
hER of great interest.
50.72 32.62
hAR E Nuclear hormone receptors have been implicated in a
50.72 30.22 variety of functions during the development of vertebrates,
hVDR I _ _ - such as morphogenesis, differentiation, and proliferation of
83.5Z 20.92
cells. It is interesting that ELP is expressed in cells in which
FIG. 6. Comparison of amino acid sequences. The number be- tissue-specific genes are repressed. One of the known func-
low each box indicates the percentage of identify of amino acids in tions of ELP is to suppress transcription of Mo-MuLV LTR.
the zinc finger region and region II of ELP. The numbers on the right Viruses have evolved in such a way that they propagate
represent the total numbers of amino acid residues. Receptors
analyzed are FTZ-F1, estrogen receptor-related genes 1 and 2 efficiently in adult tissues. Therefore, viral genomes have
(ERR1 and ERR2), human retinoid receptor (hRAR), chicken oval- features common to cellular genes expressed in somatic
bumin upstream promoter-transcription factor (COUP-TF), human cells. This makes viral sequences targets of repression in
glucocorticoid receptor (hGR), v-erbA-related genes 2 and 3 (EAR2 preimplantation-stage stem cells in which tissue-specific
and EAR3), human thyroid hormone receptor (hTR), human estro- genes are usually not expressed. Thus, in addition to Mo-
gen receptor (hER), human androgen receptor (hAR), and human MuLV LTR, ELP must have cellular targets, which may be
vitamin D3 receptor (hVDR). specifically regulated in undifferentiated stem cells of early
embryos. Identification of the cellular target of ELP is of
ELP cDNA with sequences of other nuclear hormone recep- prime importance. These cellular targets may include differ-
tors. The DNA binding domain of ELP had two zinc finger entiation-specific genes which are also suppressed by ELP.
motifs, and the first finger (amino acid positions 90 to 120), In addition to the genes which function downstream of ELP,
which determines the sequence specificity of the binding (4, an upstream factor such as a ligand, if it exists, is another
15, 37), was conserved completely between ELP and subject of importance. Although we know that ELP belongs
FTZ-F1 (data not shown). This is consistent with the spec- to the steroid receptor superfamily, the ligand for ELP has
ificity of DNA binding shared by ELP and FTZ-F1. The yet to be identified. The function of ELP, so far as we
domain involved in putative ligand binding and dimer forma- studied it in in vitro systems, may therefore reflect the
tion was also conserved between ELP and FTZ-F1, though activity of ELP without the ligand.
to a lesser degree. ELP lacks region III, which is conserved Until now, only two EC-specific transcription factors,
within known steroid receptors, and this makes ELP unique Oct3-Oct4 and Oct6, have been cloned (20, 23, 26, 29).
among members of the family.
Elucidation of the functions of these factors and of ELP will
Other members of the nuclear hormone receptor family help to explain the gene regulation in early embryogenesis.
are shown in Fig. 6 in order of homology at region I: estrogen
receptor-related genes 1 and 2 (6), the human retinoid ACKNOWLEDGMENTS
receptor (21), chicken ovalbumin upstream promoter-tran- We thank Carl Wu for permitting us to use the FTZ-F1 cDNA
scription factor (40), the human glucocorticoid receptor (11), before publication of his work, K. Umesono for information on
v-erbA-related genes 2 and 3 (18), the human thyroid hor- various steroid receptors, K. Yasuda and A. Nagutuchi for pertinent
mone receptor (39), the human estrogen receptor (8), the discussion, A. Adachi for the pRSV plasmid, T. Nishioka for
human androgen receptor (30), and the human vitamin D photographic work, and T. Matsuura for typing the manuscript.
receptor (1). ELP is the closest relative of FTZ-F1, and the This work is supported by a grant-in-aid from the Ministry of
Education, Science and Culture, Japan, by the Joint Studies Pro-
degrees of homology of regions I and II for both proteins gram of the Graduate University for Advanced Studies, and by a
were 88.4 and 55.8%, respectively. It is interesting that the grant from the Sagawa Foundation for Promotion of Cancer Re-
extent of homology for region I does not necessarily parallel search. T.T. is a recipient of a postdoctoral fellowship from the
that for region II. For example, estrogen receptor-related Japan Society for the Promotion of Science in Cancer Research.
gene 1 is next closest to ELP for region I, while v-erbA-
related gene 2 is next closest for region II. REFERENCES
1. Baker, A. R., D. P. McDonnell, M. Hughes, T. M. Crisp, D. J.
DISCUSSION Mangelsdorf, M. R. Haussler, J. W. Pike, J. Shine, and B. W.
O'Malley. 1988. Cloning and expression of full-length cDNA
The mouse homolog of Drosophila FTZ-F1 was cloned encoding human vitamin D receptor. Proc. Natl. Acad. Sci.
from the cDNA bank of a mouse EC cell line, ECA2. The USA 85:3294-3298.VOL. 12, 1992 CLONING OF LTR REPRESSOR IN EC CELLS 1291
2. Beato, M. 1989. Gene regulation by steroid hormones. Cell human retinoic acid receptor which belongs to the family of
56:335-344. nuclear receptors. Nature (London) 330:444 450.
3. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. 22. Rosenberg, A. H., B. N. Lade, D.-S. Chui, S.-W. Lin, J. J. Dunn,
Rutter. 1979. Isolation of biologically active ribonucleic acid and F. W. Studier. 1987. Vectors for selective expression of
from sources enriched in ribonuclease. Biochemistry 18:5294- cloned DNAs by T7 RNA polymerase. Gene 56:125-135.
5299. 23. Rosner, M. H., M. A. Vigano, K. Ozato, P. M. Timmons, F.
4. Danielson, M., G. Hink, and G. Ringold. 1989. Two amino acids Poirier, P. W. J. Rigby, and L. M. Staudt. 1990. A POU-domain
within the knuckle of the first zinc finger specify DNA response transcription factor in early stem cells and germ cells of the
element activation by the glucocorticoid receptor. Cell 57:1131- mammalian embryo. Nature (London) 345:686-692.
1138. 24. Sakai, H., R. Shibata, J. Sakuragi, T. Kiyomasu, M. Kawamura,
5. Gautsch, J. W., and M. C. Wilson. 1983. Delayed de novo M. Hayami, A. Ishimoto, and A. Adachi. 1991. Compatibility of
methylation in teratocarcinoma suggests additional tissue-spe- rev gene activity in the four groups of primate lentiviruses.
cific mechanisms for controlling gene expression. Nature (Lon- Virology 184:513-520.
don) 301:32-37. 25. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-
6. Giguere, V., N. Yang, P. Segui, and R. M. Evans. 1988. ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.
Identification of a new class of steroid hormone receptors. USA 74:5463-5467.
Nature (London) 331:91-94. 26. Scholer, H. R., S. Ruppert, N. Suzuki, K. Chowdhury, and P.
Downloaded from http://mcb.asm.org/ on May 11, 2021 by guest
7. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Gruss. 1990. New type of POU domain in germ line-specific
Recombinant genomes which express chloramphenicol acetyl- protein Oct-4. Nature (London) 344:435-439.
transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 27. Speck, N. A., and D. Baltimore. 1987. Six distinct nuclear
8. Greene, G. L., P. Gilna, M. Waterfield, A. Baker, Y. Hort, and factors interact with the 75-base-pair repeat of the Moloney
J. Shine. 1986. Sequence and expression of human estrogen murine leukemia virus enhancer. Mol. Cell. Biol. 7:1101-1110.
receptor complementary DNA. Science 231:1150-1154. 28. Stewart, C. L., H. Stuhlmann, D. Jahner, and R. Jaenisch. 1982.
9. Grez, M., M. Zornig, J. Nowock, and M. Ziegler. 1991. A single De novo methylation, expression, and infectivity of retroviral
point mutation activates the Moloney murine leukemia virus genomes introduced into embryonal carcinoma cells. Proc.
long terminal repeat in embryonal stem cells. J. Virol. 65:4691- Natl. Acad. Sci. USA 79:4098-4102.
4698. 29. Suzuki, N., H. Rohdewohld, T. Neuman, P. Gruss, and H. R.
10. Hilberg, F., C. Stockling, W. Ostertag, and M. Grez. 1987. Scholer. 1990. Oct-6: a POU transcription factor expressed in
Functional analysis of a retroviral host-range mutant: altered embryonal stem cells and in the developing brain. EMBO J.
long terminal repeat sequences allow expression in embryonal 9:3723-3732.
carcinoma cells. Proc. Natl. Acad. Sci. USA 84:5232-5236. 30. Tilley, W. D., M. Marcell, J. D. Wilson, and M. J. McPhaul.
11. Hollenberg, S. M., C. Weinberger, E. S. Ong, G. Cerelli, A. Oro, 1989. Characterization and expression of a cDNA encoding the
R. Lebo, E. B. Thompson, M. G. Rosenfeld, and R. M. Evans. human androgen receptor. Proc. Natl. Acad. Sci. USA 86:327-
1985. Primary structure and expression of a functional human 331.
glucocorticoid receptor cDNA. Nature (London) 318:635-641. 30a.Tsukiyama, T. Unpublished data.
12. Lavorgna, G., H. Ueda, J. Clos, and C. Wu. 1991. FTZ-Fl, a 31. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1989. Mechanism of
steroid hormone receptor-like protein implicated in the activa- suppression of the long terminal repeat of Moloney leukemia
tion of fushi tarazu. Science 252:848-851. virus in mouse embryonal carcinoma cells. Mol. Cell. Biol.
13. Linney, E., B. Davis, J. Overhauser, E. Chao, and H. Fan. 1984. 9:4670-4676.
Non-function of a Moloney murine leukemia virus regulatory 32. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1990. Characterization
sequence in F9 embryonal carcinoma cells. Nature (London) of the negative regulatory element of the 5' noncoding region of
308:470-472. Moloney murine leukemia virus in mouse embryonal carcinoma
14. Loh, T. P., L. L. Sievert, and R. W. Scott. 1990. Evidence for a cells. Virology 177:772-776.
stem cell-specific repressor of Moloney murine leukemia virus 33. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1991. Analysis of the
expression in embryonal carcinoma cells. Mol. Cell. Biol. binding proteins and activity of the long terminal repeat of
10:4045-4057. Moloney murine leukemia virus during differentiation of mouse
15. Mader, S., V. Kumar, H. de Verneuil, and P. Chambon. 1989. embryonal carcinoma cells. J. Virol. 65:2979-2986.
Three amino acids of the oestrogen receptor are essential to its
ability to distinguish an oestrogen from a glucocorticoid-respon- 34. Ueda, H., and S. Hirose. 1990. Identification and purification of
sive element. Nature (London) 338:271-274. a Bombyx mori homologue of FTZ-F1. Nucleic Acids Res.
16. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular 18:7229-7234.
cloning: a laboratory manual. Cold Spring Harbor Laboratory, 35. Ueda, H., and S. Hirose. 1991. Defining the sequence recognized
Cold Spring Harbor, N.Y. with BmFTZ-F1, a sequence specific DNA binding factor in the
17. Melin, F., R. Kemler, C. Kress, H. Pinon, and D. Blangy. 1991. silkworm, Bombyx mori, as revealed by direct sequencing of
Host range specificity of polyomavirus EC mutants in mouse bound oligonucleotides and gel mobility shift competition anal-
embryonal carcinoma and embryonal stem cells and preimplan- ysis. Nucleic Acids Res. 19:3689-3693.
tation embryos. J. Virol. 65:3029-3043. 36. Ueda, H., S. Sonoda, J. L. Brown, M. P. Scott, and C. Wu. 1990.
18. Miyajima, N., Y. Kadowaki, S. Fukushige, S. Shimizu, K. A sequence-specific DNA binding protein that activates fushi
Semba, Y. Yamanashi, K. Matsubara, K. Toyoshima, and T. tarazu segmentation gene expression. Genes Dev. 4:624-635.
Yamamoto. 1988. Identification of two novel members of erbA 37. Umesono, K., and R. Evans. 1989. Determinants of target gene
superfamily by molecular cloning: the gene products of the two specificity for steroid/thyroid hormone receptors. Cell 57:1139-
are highly related to each other. Nucleic Acids Res. 16:11057- 1146.
11074. 38. Weiher, H., E. Barklis, W. Ostertag, and R. Jaenisch. 1987. Two
19. Niwa, O., Y. Yokota, H. Ishida, and T. Sugahara. 1983. Inde- distinct sequence elements mediate retroviral gene expression
pendent mechanisms involved in suppression of the Moloney in embryonal carcinoma cells. J. Virol. 61:2742-2746.
leukemia virus genome during differentiation of murine terato- 39. Weinberger, C., C. C. Thompson, E. S. Ong, R. Lebo, D. J.
carcinoma cells. Cell 32:1105-1113. Gruol, and R. M. Evans. 1986. The c-erb-A gene encodes a
20. Okamoto, K., H. Okazawa, A. Okuda, M. Sakai, M. Mura- thyroid hormone receptor. Nature (London) 324:641-646.
matsu, and H. Hamada. 1990. A novel octamer binding tran- 40. Wong, L.-H., S. Y. Tsai, R. G. Cook, W. G. Beattie, M.-J. Tsai,
scription factor is differentially expressed in mouse embryonal and B. W. O'Malley. 1989. COUP transcription factor is a
carcinoma cells. Cell 60:461-472. member of the steroid receptor superfamily. Nature (London)
21. Petkovich, M., N. J. Brand, A. Krust, and P. Chambon. 1987. A 340:163-166.You can also read
