Funny Current Downregulation and Sinus Node Dysfunction Associated With Atrial Tachyarrhythmia
←
→
Page content transcription
If your browser does not render page correctly, please read the page content below
Funny Current Downregulation and Sinus Node Dysfunction
Associated With Atrial Tachyarrhythmia
A Molecular Basis for Tachycardia-Bradycardia Syndrome
Yung-Hsin Yeh, MD*; Brett Burstein, PhD*; Xiao Yan Qi, PhD*; Masao Sakabe, MD, PhD;
Denis Chartier, MSc; Philippe Comtois, PhD; Zhiguo Wang, PhD;
Chi-Tai Kuo, MD; Stanley Nattel, MD
Background—Sinoatrial node (SAN) dysfunction is frequently associated with atrial tachyarrhythmias (ATs). Abnormal-
ities in SAN pacemaker function after termination of ATs can cause syncope and require pacemaker implantation, but
underlying mechanisms remain poorly understood. This study examined the hypothesis that ATs impair SAN function
by altering ion channel expression.
Methods and Results—SAN tissues were obtained from 28 control dogs and 31 dogs with 7-day atrial tachypacing (400
bpm). Ionic currents were measured from single SAN cells with whole-cell patch-clamp techniques. Atrial
tachypacing increased SAN recovery time in vivo by ⬇70% (P⬍0.01), a change which reflects impaired SAN
function. In dogs that underwent atrial tachypacing, SAN mRNA expression (real-time reverse-transcription polymerase
chain reaction) was reduced for hyperpolarization-activated cyclic nucleotide– gated subunits (HCN2 and HCN4) by
⬎50% (P⬍0.01) and for the -subunit minK by ⬇42% (P⬍0.05). SAN transcript expression for the rapid
delayed-rectifier (IKr) ␣-subunit ERG, the slow delayed-rectifier (IKs) ␣-subunit KvLQT1, the -subunit MiRP1, the
L-type (ICaL) and T-type (ICaT) Ca2⫹-current subunits Cav1.2 and Cav3.1, and the gap-junction subunit connexin 43 (were
unaffected by atrial tachypacing. Atrial tachypacing reduced densities of the HCN-related funny current (If) and IKs by
⬇48% (P⬍0.001) and ⬇34% (P⬍0.01), respectively, with no change in voltage dependence or kinetics. IKr, ICaL, and
ICaT were unaffected. SAN cells lacked Ba2⫹-sensitive inward-rectifier currents, irrespective of AT. SAN action potential
simulations that incorporated AT-induced alterations in If accounted for slowing of periodicity, with no additional
contribution from changes in IKs.
Conclusions—AT downregulates SAN HCN2/4 and minK subunit expression, along with the corresponding currents If and
IKs. Tachycardia-induced remodeling of SAN ion channel expression, particularly for the “pacemaker” subunit If,
may contribute to the clinically significant association between SAN dysfunction and supraventricular
tachyarrhythmias. (Circulation. 2009;119:1576-1585.)
Key Words: sinoatrial node 䡲 pacing 䡲 arrhythmia 䡲 ion channels 䡲 electrophysiology
I t is well-established that sinoatrial node (SAN) dysfunction
is common in patients with atrial fibrillation (AF) and can
lead to syncopal attacks after AF termination, a condition
the condition, Elvan et al5 demonstrated in an elegant study
that electrically induced AF causes SAN dysfunction in dogs,
with SAN abnormalities becoming reversed within a week
often called the tachycardia-bradycardia syndrome.1,2 Al- after AF termination. SAN dysfunction noted after termina-
though abnormalities of SAN structure have been noted in tion of chronic atrial flutter was also found to reverse itself
patients with AF,3 there is increasing evidence of a reversible over several weeks,6 which supports the notion that atrial
component related to SAN remodeling caused by rapid atrial tachyarrhythmias lead to reversible SAN dysfunction in
tachyarrhythmias. SAN dysfunction is commonly noted 1 day humans. Subsequently, Hocini et al7 demonstrated that when
after electrical cardioversion in patients with lone AF.4 AF patients show prolonged sinus pauses on AF termination,
Although this finding was originally believed to be due to the successful AF ablation is followed by marked recovery in
intrinsic electrophysiological abnormalities that characterize SAN function indices.
Received April 30, 2008; accepted October 17, 2008.
From the Department of Medicine (Y.-H.Y., B.B., X.Y.Q., M.S., D.C., P.C., Z.W., S.N.), Department of Physiology and Institute of Biomedical
Engineering (P.C.), Montreal Heart Institute Research Center and Université de Montréal, Montreal, Quebec, Canada; Department of Pharmacology and
Therapeutics (B.B., S.N.), McGill University, Montreal, Quebec, Canada; and the First Cardiovascular Division, Chang-Gung Memorial Hospital and
Chang-Gung University (Y.-H.Y., C.-T.K.) Tao-Yuan, Taiwan.
*The first 3 authors contributed equally to this work.
The online-only Data Supplement is available with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.108.789677/DC1.
Correspondence to Stanley Nattel, 5000 Belanger St E, Montreal, H1T 1C8, Quebec, Canada. E-mail stanley.nattel@icm-mhi.org
© 2009 American Heart Association, Inc.
Circulation is available at http://circ.ahajournals.org DOI: 10.1161/CIRCULATIONAHA.108.789677
1576
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015Yeh et al SA Node Ion Channels in Tachy-Brady Syndrome 1577
Table. Gene-Specific Primers (and TaqMan Probe Sequences) Used in Real-Time RT-PCR Analysis
Gene Forward Primer Sequence Reverse Primer Sequence Probe Sequence Accession No.
Cav1.2 GACATTGTTTTCACTACCATTTTCACCAT GGCAAAAAGAGCCCTTATGTAGGAA ATCTTCAGAGCAATTTC XM_534932
Cav3.1 GAGGACATCGCCTGTGACT GGCAAAGAAGGCAAAGATGAAGTC ATCCTGCAGGCCTTTG XM_860802
Cx43 ACTCTTGTACCTGGCTCATGTG ACCTTGCCGTGCTCTTCAAT NM_001002951
ERG GCAAAGTGGAGATCGCCTTCTAC CATCCACCAGGCACAGGAA CAGCTCCCATCCTTCC NM_001003145
HCN2 GCGGCGCCAGTACCA GCAGCTTGTGGAAGGACATGTA CCTGCTTGTACTTCTCC XM_850140
HCN4 CTGGGCGAGCTGAGTGA CCAGCTTCCGGCAGTTGAA CTGAGGGAGGAGATCATCAA XM_535535
Kv4.3 TCCCCTGTTATCTGTACGAACCT TTCTGCTCAAACATCTGCTCATCT CCACCATCAAGAACCA XM_845974
KvLQT1 ATTCGGCGCATGCAGTACTT TTGATGCGCACCATGAGGTT XM_540790
minK GGCTCTAGATCAGGAACCTTCTTG CACGAAGGCCAAACATCACA CCTGCAGCCGGTCACT XM_544868
MiRP1 CCATCCTGGTGAGCACTGT AGTCCTCTACAATGTACTGGTGGTA CCGTCTCTTGGATTTC XM_544867
and severing of the vagus nerves in the neck.2 The RA was then
Clinical Perspective p 1585 paced at cycle lengths (CLs) of 250 or 300 ms for 1 minute. The
Despite extensive accumulating evidence for atrial corrected sinus node recovery time (SNRTc) was obtained from the
interval from the last paced atrial activation to the first sinus escape
tachyarrhythmia–induced SAN dysfunction, the underlying beat, minus the prepacing spontaneous CL.
mechanisms have remained unclear. Atrial tachyarrhythmias,
including AF, cause substantial remodeling of the ionic current RNA Extraction and TaqMan Real-Time
properties of atrial cardiomyocytes, which causes action poten- Polymerase Chain Reaction
tial abbreviation that increases vulnerability to AF induction and RNA was isolated from tissue samples by guanidine thiocyanate-
maintenance.8 It is quite conceivable that SAN ionic current phenol-chloroform extraction, then treated with DNase (RNeasy
changes induced by AF lead to the depressed SAN function that mini kit, Qiagen, Valencia, Calif), quantified, and subjected to
quality control by microelectrophoresis on polyacrylamide gels
characterizes the tachycardia-bradycardia syndrome. (Agilent 2100 Bioanalyzer, Agilent Technologies Inc, Santa Clara,
The present study tested the hypothesis that sustained atrial Calif).1 DNA contamination was excluded by reverse-transcription–
tachycardia alters ionic current properties in SAN cardiomyo- negative polymerase chain reaction (PCR). First-strand complemen-
cytes, thereby causing SAN dysfunction. We first studied tary DNA was synthesized from 2 g of total RNA with a
changes in the expression of SAN ion channel subunits that high-capacity cDNA archive kit (Applied Biosystems, Foster City,
Calif). Real-time quantitative PCR was performed with either 6-car-
resulted from 1 week of atrial tachypacing (ATP) at 400 bpm, boxy-fluorescein–labeled fluorogenic TaqMan primers and probes
a recognized paradigm of AF-related atrial tachycardia re- (assay-by-design) with TaqMan universal master mix (Applied
modeling.8,9 We then developed the necessary methods to Biosystems) or custom primers (Invitrogen, Carlsbad, Calif) with
isolate canine SAN cardiomyocytes and performed voltage- SYBR Green master mix (Applied Biosystems; sequences provided
in the Table). Fluorescence signals were detected with the Strat-
clamp studies to characterize the effects of ATP on their ionic agene Mx3000P sequence-detection system (Stratagene, La Jolla,
currents. Our results implicate alterations of the funny cur- Calif) in duplicate, normalized to the reference (18S ribosomal
rent, If, in atrial tachyarrhythmia–induced SAN dysfunction. RNA, Applied Biosystems), and quantified with MxPro QPCR
software (Stratagene).
Methods
SAN Cardiomyocyte Isolation
Animal Handling and Tachypacing Protocol An RA preparation containing the SAN region was perfused at ⬇10
Animal care procedures were consistent with National Institutes of mL/min via the right coronary artery for cardiomyocyte isolation.9
Health guidelines and were approved by the animal research ethics The preparation was first perfused with 2 mmol/L Ca2⫹-containing
committee of the Montreal Heart Institute. Adult mongrel dogs Tyrode solution until all leaking coronary artery branches were
(weight 25 to 35 kg; Laka Inc, Saint-Basile-le-Grand, Quebec, ligated, followed by Ca2⫹-free Tyrode solution for 15 minutes. Then,
Canada) were instrumented with a unipolar right-atrial (RA) lead Ca2⫹-free Tyrode solution that contained collagenase (110 U/mL
attached to a pacemaker programmed to provide 1 week of RA CLS II collagenase; Worthington Biochemical, Lakewood, NJ) and
pacing at 400 bpm. Ventricular rate control was ensured by radio- 0.1% bovine serum albumin was used to perfuse the preparation for
frequency ablation–induced AV block, with a right ventricular ⬇40 minutes. The SAN region was identified as a whitish endocar-
demand pacemaker set at 80 bpm. ATP dogs (n⫽31) were compared dial zone near the junction between the superior vena cava and the
with control dogs (n⫽28) that were similarly instrumented but with RA appendage. Dispersed cells were stored in a high-K⫹ storage
the RA pacemaker inactivated. At the time the animals were solution.
euthanized, SAN cardiomyocytes were isolated for electrophysiolog-
ical study, and SAN and RA free-wall (RAFW) tissue samples were SAN Cellular Electrophysiology
collected, snap-frozen in liquid N2, and stored at ⫺80°C. Currents were recorded with whole-cell patch clamping at 36⫾0.5°C
as described previously.9 Potential SAN cardiomyocytes were iden-
Sinus Node Recovery Time Changes tified on the basis of distinct morphologies (fine, elongated spindle-
On study days, dogs were anesthetized (morphine 2 mg/kg SC; like or spider-shaped cells; see supplemental Figure I). Only cells
␣-chloralose 120 mg/kg IV load, 29.25 mg · kg⫺1 · h⫺1) and presenting If, which was never seen in atrial cardiomyocytes, were
mechanically ventilated. Bipolar pacing and recording hook elec- selected for SAN cell current recording. Borosilicate glass electrodes
trodes were inserted into the RA appendage. The baseline sinus rate had tip resistances between 2.0 and 4.0 M⍀ when filled. Compen-
was measured after suppression of potentially confounding vagal and sated series resistances and capacitive time constants averaged
-adrenergic influences by administration of nadolol (0.5 mg/kg IV) 3.4⫾0.3 M⍀ and 289⫾64 s, respectively. SAN cell capacitance
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 20151578 Circulation March 31, 2009
Figure 1. In vivo recordings at baseline
and immediately after overdrive pacing for
sinus node recovery time (SNRT) mea-
surements. A, Representative atrial ECG
recordings from control (CTL) and ATP
(AT-P) dogs. Left, Prepacing baseline AA
recordings after vagotomy and intrave-
nous nadolol. Right, Postpacing (at a CL
of 250 ms) AA recordings. The SNRT was
the first postpacing A-A interval. SNRTc
was calculated as SNRT minus the mean
prepacing AA CL. B, Mean⫾SEM sinus
CL at baseline after vagotomy/intravenous
nadolol. C, Mean⫾SEM SNRTc at 250
and 300 ms pacing CLs. N⫽12 dogs per
group. *P⬍0.05, ***P⬍0.01; analysis in B
by unpaired Student t test, in C by
repeated-measures 2-way ANOVA.
averaged 80⫾5 pF (n⫽30) for control dogs and 85⫾3 pF (n⫽44) for each parameter value set were run for 100 seconds. The last 2
tachypaced dogs. Original recordings are presented in terms of seconds of simulation were then analyzed to compare the effects of
absolute current amplitude, but mean data are shown as current the observed degrees of If and IKs remodeling on SAN activity.
density (pA/pF). Junction potentials averaged 15.0⫾0.7 mV and were
corrected only for resting-potential measurements. Resting potentials Statistical Analysis
averaged ⫺52⫾1 mV in control and ⫺53⫾1 mV in tachypaced SAN Data are expressed as mean⫾SEM. Repeated-measures 2-way
cells (n⫽14 and 17 cells, respectively, from 3 dogs each). ANOVA and Bonferroni-adjusted t tests were used for statistical
comparisons of current-voltage relations. Reverse-transcription PCR
Solutions data (nonrepeated measures) were also analyzed by 2-way ANOVA.
The cell-storage solution contained (in mmol/L) KCl 20, KH2PO4 10, When ANOVA revealed a statistically significant interaction,
dextrose 10, mannitol 40, L-glutamic acid 70, -OH-butyric acid 10, Bonferroni-adjusted comparisons were performed to compare indi-
taurine 20, EGTA 10, and 0.1% bovine serum albumin (pH 7.3, vidual group means by multiplying each probability value by the
KOH). Tyrode (extracellular) solution contained (in mmol/L) NaCl number of comparisons. In the absence of significant interactions,
136, KCl 5.4, MgCl2 1, NaH2PO4 0.33, HEPES 5, and dextrose 10 statistical data are presented only in terms of main effects (region
(pH 7.35, NaOH), with CaCl2 of 1 mmol/L for If recording and 2 or [SAN versus RA] or condition [control versus ATP]). An unpaired
0 mmol/L for cell isolation. The internal solution for If and K⫹-current Student t test was used to compare spontaneous CL between control
recording contained (in mmol/L) K-aspartate 110, KCl 20, MgCl2 1, and ATP-remodeled dogs. Analyses of ionic currents controlled for
MgATP 5, Li-GTP 0.1, HEPES 10, Na-phosphocreatine 5, and dog of origin as a variable to avoid weighting results from different
EGTA 5 (pH 7.3, KOH). Ba2⫹ (1 mmol/L)-sensitive current was used dogs by the number of cells studied. A 2-tailed probability value
to assess inward-rectifier K⫹ currents as described previously.9 For ⬍0.05 was considered statistically significant. Clampfit 9.0 (Axon
IKs recording, nifedipine (5 mol/L), 4-aminopyridine (2 mmol/L), Instruments, Foster City, Calif) and GraphPad Prism 3.0 (GraphPad,
dofetilide (1 mol/L), and atropine (200 nmol/L) were added to San Diego, Calif) software were used for data analysis.
suppress ICaL, Ito, IKr, and 4-aminopyridine– dependent muscarinic K⫹ The authors had full access to and take full responsibility for the
currents. For IKr recording, the same solutions were used as for IKs, integrity of the data. All authors have read and agree to the
except dofetilide was not included and the IKs blocker HMR 1556 manuscript as written.
(0.5 mol/L) was added. The external solution for ICa recording
contained (in mmol/L) tetraethylammonium chloride 136, CsCl 5.4, Results
CaCl2 2, MgCl2 0.8, HEPES 10, and dextrose 10 (pH 7.4, CsOH).
Niflumic acid (50 mol/L) was added to inhibit Ca2⫹-dependent Cl⫺ SAN Recovery Times In Vivo
current . The internal solution for ICa recording contained (in mmol/L) Figure 1A illustrates RA electrogram recordings used to
CsCl 120, TEA-Cl 20, MgCl2 1, MgATP 5, Li-GTP 0.1, EGTA 10, and calculate the SNRTc. The left panel shows baseline after
HEPES 10 (pH 7.3, CsOH). Unless otherwise specified, chemicals were
obtained from Sigma Chemicals (St Louis, Mo).
vagotomy and nadolol administration, whereas the right panel
shows recordings just before and after the end of tachypacing.
Transmembrane Potential Simulations There was a clear delay to the emergence of the first
The Kurata model of the rabbit SAN cell action potential10 was spontaneous postpacing beat, which was enhanced after 1
modified to produce a spontaneous rate similar to that in dogs in the week of ATP. After vagotomy and nadolol administration,
present study (the sustained inward current [Ist] was set to zero) and the sinus CL was longer in ATP dogs than in control
implemented in C⫹⫹ on an AMD64 processor– based computer
(AMD, Sunnyvale, Calif). Model implementation used a variable (P⬍0.05), which indicates reduced intrinsic SAN automatic-
time-step algorithm (Runge-Kutta-Merson fourth-order integration ity (Figure 1B). SNRTc was substantially prolonged in ATP
scheme) with maximum relative tolerance of 10⫺6. Simulations with dogs versus controls (Figure 1C).
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015Yeh et al SA Node Ion Channels in Tachy-Brady Syndrome 1579
Figure 2. Real-time reverse-transcription PCR.
Mean⫾SEM mRNA expression of If-associated
subunits (A–C), IK-related subunits (D–F), ICaL and
ICaT subunits (G and H), and Cx43 (I). N⫽8 to 10
per group. *P⬍0.05, ***P⬍0.001 for individual
group mean differences by Bonferroni-adjusted t
test in the presence of significant group-by-region
interaction; ††P⬍0.01, †††P⬍0.001 for main effect
of region; ‡‡P⬍0.01 for main effect of condition;
by 2-way ANOVA. CTL indicates control;
AT-P, ATP.
Ion Channel Subunit Expression IK Subunits
ATP causes atrial electrical remodeling, which alters the Expression of the ␣-subunits corresponding to IKr (ERG;
mRNA expression of ion channel subunits.8 Quantitative Figure 2D) and IKs (KvLQT1; Figure 2E) was similar for
reverse-transcription PCR was used to investigate ATP- RAFW versus SAN tissues, and neither was significantly
induced changes in mRNA expression profiles and to com- altered by ATP. The IKs -subunit minK (Figure 2F) was
pare SAN and RAFW expression patterns to support tissue- more strongly expressed in SAN than in RAFW (main effect
identification validity (Figure 2). of region: F⫽12.42, dfn⫽1, dfd⫽33, P⫽0.0013) and was
globally reduced by ATP (main effect of condition: F⫽11.48,
If Subunits dfn⫽1, dfd⫽33, P⫽0.0018).
The mRNA expression levels of hyperpolarization-activated
cyclic nucleotide– gated subunits (HCN2 and HCN4) were ICa Subunits
enriched in control SAN tissue versus RAFW (⬇5.5-fold and The L-type Ca2⫹ current (ICaL) ␣-subunit Cav1.2 (main effect
12-fold, respectively, P⬍0.001 for both; Figures 2A and 2B). of region: F⫽22.95, dfn⫽1, dfd⫽32, P⬍0.0001; Figure 2G)
There was a statistically significant interaction between and T-type Ca2⫹ current (ICaT) ␣-subunit Cav3.1 (main effect
region (RAFW and SAN) and condition (control versus ATP) of region: F⫽10.25, dfn⫽1, dfd⫽33, P⫽0.0030; Figure 2H)
in expression of both HCN2 (F⫽5.67, dfn⫽1, dfd⫽34, were both more strongly expressed in SAN than in RAFW.
P⫽0.023) and HCN4 (F⫽6.07, dfn⫽1, dfd⫽34, P⫽0.019), Neither subunit was significantly affected by ATP.
which indicates that region is a determinant of the response to Connexin43
ATP. ATP reduced SAN expression of both HCN2 (by 56%, There was a significant interaction between region and
P⬍0.05) and HCN4 (59%, P⬍0.05). There was no interac- condition for connexin 43 (Cx43) expression (F⫽26.21,
tion between region and condition for the putative If dfn⫽1, dfd⫽32, P⬍0.0001; Figure 2I). In control tissue,
-subunit MiRP1 (Figure 2C), but there was a significant Cx43 was expressed ⬇3.4-fold more in RAFW than in SAN
main effect of region (F⫽15.70, dfn⫽1, dfd⫽30, P⫽0.0004), (P⬍0.001). Although ATP had no effect on SAN Cx43
with greater expression in SAN than in RAFW, which was expression, tachypacing downregulated Cx43 by 48%
unchanged by tachypacing. (P⬍0.001) in RAFW.
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 20151580 Circulation March 31, 2009
Figure 3. Reduction of SAN hyperpolarization-activated current (If) by atrial tachycardia remodeling. A, Representative If recordings
from control (CTL; left) and ATP (AT-P; right) SAN cardiomyocytes. B, Mean⫾SEM If step-current density-voltage relations. C, Activa-
tion kinetics of step If. D, Voltage-dependent If activation. N⫽14 cells from 10 dogs for control and 16 cells from 10 dogs for ATP. TP
indicates test potential. *P⬍0.05, **P⬍0.01, ***P⬍0.001, by repeated-measures 2-way ANOVA.
Reference Gene 3D). The V1/2 and slope-constant values obtained from Bolt-
Expression of the reference gene, which encoded 18S ribo- zmann fits of data in each experiment averaged ⫺72.4⫾3.0
somal RNA, was comparable among groups (RAFW control and ⫺8.3⫾1.1 mV, respectively, for control cells and
6.38⫾0.47; RAFW ATP 6.75⫾0.63; SAN control ⫺76.4⫾3.3 and ⫺7.6⫾1.3 mV, respectively, for ATP cells.
6.68⫾0.67; SAN ATP 6.77⫾0.31). We also recorded Ba2⫹-sensitive K⫹ currents in SAN cells
to assess their constitutive acetylcholine-regulated (IKACh) and
Hyperpolarization-Activated Currents background inward-rectifier (IKl) expression phenotype and to
Ionic currents were selected for measurement on the basis of evaluate possible ATP-induced inward-rectifier current up-
the mRNA data. The 2 currents that showed significant regulation of the type previously observed in atrial cells.8
subunit expression changes (If and IKs) were recorded, along Supplemental Figures IIA and IIB show such current record-
with 2 Ca2⫹ currents believed to play important roles in SAN ings from 1 SAN cell before and after exposure to 1 mmol/L
pacemaking4 that showed no significant alteration in Ba2⫹. Consistent with very limited IKl expression in the SAN
␣-subunit expression (ICaL and ICaT) and 1 K⫹ current that region, Ba2⫹ had no clear effect on the currents, and the
showed no mRNA change (IKr). Figure 3A shows represen- Ba2⫹-sensitive currents obtained by digital subtraction (sup-
tative recordings of If in control and ATP cells. Both plemental Figure IIC) were negligible. Mean Ba2⫹-sensitive
time-dependent activating (Figure 3B) and tail-current com- current-voltage density relations in SAN cells are illustrated
ponents of If were significantly reduced by ATP. For exam- in supplemental Figure IID and contrasted with correspond-
ple, at a step voltage of ⫺140 mV, If was reduced from ing results in RA cardiomyocytes. Unlike SAN cells, atrial
⫺10.8⫾1.0 pA/pF in control cells to ⫺6.0⫾1.0 pA/pF in cardiomyocytes showed clear Ba2⫹-sensitive currents with
ATP cells (P⬍0.001). If activation kinetics were well fitted current-voltage relations typical of inward-rectifier K⫹ cur-
by biexponential relations and were not affected by ATP rents. These results support the characteristic ion channel
(Figure 3C), showing similar fast (fast) and slow (slow) properties of the canine SAN cells that we studied, because
activation time constants, of the order of 50 to 200 and 250 to lack of IKl is characteristic of most mammalian SAN cells.11
1000 ms, respectively, over the full voltage range. To analyze In addition, we recorded Ba2⫹-sensitive currents in SAN cells
steady state activation voltage dependence, If tail currents on isolated from ATP dogs. As shown by the results in supple-
repolarization to ⫺140 mV were normalized by the maxi- mental Figure IID, no significant Ba2⫹-sensitive currents were
mum tail-current value and plotted as a function of the detected, which indicates the absence of inward-rectifier
preceding step potential. Tachypacing did not significantly current (IKl or constitutive IKACh) upregulation by ATP in SAN
affect the activation variable at different voltages (Figure cells.
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015Yeh et al SA Node Ion Channels in Tachy-Brady Syndrome 1581
Figure 4. Reduction of SAN slow
delayed-rectified K⫹ current (IKs) by atrial
tachycardia remodeling. A, Representative
IKs recordings from control (CTL; left) and
ATP (AT-P; right) SAN cardiomyocytes.
B and C, Mean⫾SEM IKs step- and tail-
current density-voltage relations. D,
Mean⫾SEM normalized IKs tail-current
density-voltage relation. E, Activation
kinetics of step IKs and deactivation kinet-
ics of tail IKs. N⫽15 cells from 10 dogs
per group. *P⬍0.05, **P⬍0.01, ***P⬍0.001,
by repeated-measures 2-way ANOVA.
Delayed-Rectifier Currents step-current activation and tail-current deactivation showed
The slow delayed-rectifier current IKs plays important roles in no significant differences between control and ATP values, as
SAN pacemaking in most species,11 and IKs -subunit minK illustrated in Figure 4E.
gene expression was downregulated. Figure 4A shows re- Results of rapid delayed-rectifier current recordings are
cordings of IKs in control and ATP cells. Both the step (Figure shown in Figure 5. IKr tail currents were recorded during
4B) and tail (Figure 4C) currents were significantly reduced 4-second repolarizing pulses to ⫺40 mV after a 2-second
by ATP. For example, the IKs step-current density at 60 mV activating pulse to voltages between ⫺40 and 70 mV. As
was reduced from 12.3⫾0.7 pA/pF in control to 8.8⫾0.7 shown in Figures 5A and 5B, IKr tail currents were small in
pA/pF in ATP cells (P⬍0.001), whereas the tail current density canine SAN cells, both from dogs without and with ATP.
was reduced from 2.9⫾0.3 pA/pF in control to 1.9⫾0.2 pA/pF Figure 5C shows mean tail-current density-voltage relations,
in ATP (P⬍0.01). Voltage dependence of IKs activation (tail- which were unchanged by ATP.
current analysis) was not altered by tachypacing (Figure 4D),
with control and ATP cells showing similar mean V1/2 values, Calcium Currents
which averaged 10.2⫾2.1 and 13.5⫾2.4 mV, respectively. Ca2⫹ currents are important in SAN pacemaking,11 and atrial
The time courses of both step-current activation on depolar- tachyarrhythmias have been shown to change atrial ICaL, with
ization to 60 mV and tail-current deactivation on repolariza- both transcriptional and posttranscriptional mechanisms hav-
tion from 60 to ⫺40 mV were biexponential. Time constants ing been implicated.8 Accordingly, we compared ICaL and ICaT
corresponding to both the slow and fast components of in SAN cells from control and ATP dogs. Original ICaL
Figure 5. Unchanged SAN rapid delayed-rectifier K⫹ current (IKr) in atrial tachycardia remodeling. A and B, IKr recordings from control
(CTL; A) and ATP (AT-P; B) SAN cardiomyocytes. C, Mean⫾SEM IKr tail-current density-voltage relations from 14 cells from 3 control
dogs and 26 cells from 5 ATP dogs. Analysis by repeated-measures 2-way ANOVA. TP indicates test potential.
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 20151582 Circulation March 31, 2009
Figure 6. Unaltered SAN calcium currents (ICaL and ICaT) with atrial tachycardia remodeling. A, Representative recordings of ICaL from
control (CTL; left) and ATP (AT-P; right) SAN cardiomyocytes. B, Mean⫾SEM ICaL density-voltage relations; n⫽12 cells from 4 dogs per
group. C, Representative recordings of calcium current from control and ATP cardiomyocytes, respectively. The currents were recorded
with holding potentials of ⫺90 mV and ⫺50 mV. The subtracted currents represent ICaT. D, Mean⫾SEM ICaT density-voltage relations;
n⫽10 cells from 4 dogs per group. Analysis by repeated-measures 2-way ANOVA. TP indicates test potential.
recordings are shown in Figure 6A. ICaL densities were absence of autonomic influences (vagotomy/nadolol). Simu-
comparable between ATP and control cells (Figure 6B). For lation of the decrease in If and IKs together did not appreciably
example, at 10 mV, ICaL density averaged ⫺4.6⫾0.6 pA/pF in alter the slowing effect of simulated ATP compared with If
control and ⫺4.1⫾0.7 pA/pF in ATP cells, respectively. effects alone (CL 443.6 ms with If reduction alone versus
Original recordings corresponding to total ICa (including both 443.4 ms with combined IKs/If reduction).
ICaL and ICaT components) obtained on depolarization from
⫺90 to ⫺20 mV and recordings from the same cells that Discussion
reflect ICaL without a contribution from ICaT (obtained by We have completed a detailed analysis of the functional and
depolarization from ⫺50 to ⫺20 mV) are shown in Figure gene expression changes for selected ion channel subunits of
6C. T-type current was obtained by subtracting currents SAN cells isolated from dogs subjected to 1 week of atrial
recorded with a holding potential of ⫺50 mV from current tachycardia remodeling. The results indicate significant
recorded with a holding potential of ⫺90 mV, as described changes in the expression of specific subunits involved in
previously.9 ICaT was not present in all SAN cells but was SAN pacemaking, with alterations in If appearing to be
found in a large and similar proportion (⬇70%) of both particularly important for associated SAN dysfunction.
control and ATP cells. No significant change in ICaT (Figure
6D) current density-voltage relations was produced by ATP; Mechanisms Underlying Reversible SAN Dysfunction
for example, ICaT at ⫺20 mV was ⫺1.4⫾0.4 for control in Tachycardia-Bradycardia Syndrome
versus ⫺1.3⫾0.2 pA/pF for ATP cells. Early studies implicated anatomic structural abnormalities in
SAN dysfunction associated with atrial tachyarrhythmias,
Transmembrane Potential Simulations which suggests a fixed SAN dysfunction substrate1,3; how-
Simulation of SAN cell action potentials provided the spon- ever, several subsequent lines of evidence have pointed to an
taneous activity shown by the blue curves in Figure 7. The important functional, and potentially reversible, component.
results of different combinations of If and IKs remodeling are Elvan et al5 showed that electrically sustained AF over 2 to 6
superimposed in specific colors. Remodeling of IKs alone was weeks induced SAN dysfunction in parallel with atrial re-
simulated by reproducing the same mean density decrease modeling and that significant SAN recovery occurred within
(35%) obtained in voltage-clamp recordings and did not 1 week of AF cessation. These observations were confirmed
change spontaneous SAN cell periodicity (CL 407.8 ms in by studies that showed that SAN dysfunction due to atrial
control versus 407.7 ms with reduced IKs). A 50% decrease in tachycardia remodeling was fully reversed 4 weeks after
If slowed periodic activity by increasing the CL ⬇9%, which tachycardia cessation.12 Termination of chronic atrial flutter
was a change of the same order as but slightly less than the in humans is followed by progressive improvement in SNRTc
increase in spontaneous CL seen with ATP (13.8%) in the abnormalities over 3 weeks, which supports the applicability
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015Yeh et al SA Node Ion Channels in Tachy-Brady Syndrome 1583
Figure 7. Simulations of SAN transmem-
brane potential showing changes in spon-
taneous periodicity caused by reductions
in If, IKs, and If and IKs together. V indi-
cates voltage; t, time.
of the experimental findings to clinical tachyarrhythmias.6 density. The tachycardia-induced downregulation of ICaL and
Paroxysmal AF patients with prolonged (⬎3 seconds) sinus upregulation of inward-rectifier K⫹ currents that are believed
pauses on AF termination show progressive improvements in to be of great functional importance at the atrial level8 are not
sinus node function after AF ablation, with a clinical evolu- observed in SAN cells.
tion that indicates an absence of clinically significant SAN mRNA profiling in the present study showed some inter-
disease.7 The results obtained in the present study provide a esting differences between ATP-induced remodeling in SAN
potential ionic current mechanism to explain these experi- and RAFW. HCN subunits were downregulated only in SAN
mental and clinical observations, based on atrial tissue, and Cx43 was downregulated only in RAFW. The IKs
tachycardia–induced remodeling of SAN ion channel expres- -subunit minK was downregulated in both SAN and RAFW.
sion and function. If contributes to cellular automaticity by Although we found SAN IKs to be downregulated by ATP in
depolarizing cells toward their threshold potential, whereas the present study, previous reports have not described corre-
IKs can contribute by accelerating phase 3 repolarization and sponding changes in atrial tissue.9 Cav1.2 mRNA expression
advancing the time when the cell begins spontaneous phase 4 was not altered by ATP in either SAN or RAFW. The SAN
depolarization. Our mathematical modeling analyses suggest result is consistent with unchanged SAN ICaL in the present
that the If changes caused by atrial tachycardia remodeling study, but the atrial findings are discrepant with results of
largely account for the associated SAN dysfunction. The lack previous investigations of ATP-induced atrial remodeling.8
of a significant role for IKs changes is likely due to the very The reason for this discrepancy in atrial Cav1.2 mRNA
positive activation potential for this current,9 which is not changes is unclear and may relate to technical factors or the
attained by SAN cells with their low resting potential and site of atrial sampling, but a detailed experimental analysis
limited overshoot.11 goes beyond the scope of the present study.
The basis for the differential atrial tachycardia remodeling
Relationship to Previous Studies of Atrial response of atrial cardiomyocyte ionic currents versus those
Tachycardia Remodeling and Disease-Related in SAN cells is unclear. Although we were unable to identify
SAN Dysfunction previous studies of SAN cell ion-channel remodeling with atrial
Atrial ionic current remodeling due to sustained atrial tachycardia, Verkerk et al19 have analyzed in detail the
tachycardia has been evaluated in detail. The principal changes in SAN ionic currents caused by congestive heart
changes include downregulation of ICaL8,9,13,14 and Ito8,9,14,15 failure in rabbits with chronic pressure and volume overload.
and upregulation of inward-rectifier K⫹ currents.8,14 –18 Atrial They found changes quite similar to those we noted here, with
delayed-rectifier K⫹ current function is not altered by atrial decreases in If and IKs and lack of change in the other currents
tachycardia.8,9 Changes in atrial If function have not been they studied. The alterations that they observed were of the
described in atrial tachycardia remodeling. The profile of same order that we saw but were slightly smaller: ⬇40%
atrial tachycardia–induced SAN remodeling differs substan- versus ⬇50% decrease in If and ⬇20% versus ⬇35% de-
tially from changes seen at the atrial level, being dominated crease in IKs. They also performed mathematical modeling to
by alterations in HCN subunits and If function, along with assess the relative importance of If and IKs changes to altered
statistically significant changes in minK expression and IKs SAN automaticity, and like us, they concluded that If down-
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 20151584 Circulation March 31, 2009
regulation is the principal contributor. Verkerk et al19 did not for study on the basis of SAN localization in the dog that we
examine the molecular basis of the SAN ionic current identified in previous studies,20 and we used well-described
remodeling they observed with congestive heart failure, but morphological criteria24,25 to define SAN-derived spider and
we subsequently studied HCN subunit expression changes in spindle cells. The SAN preparations that we used for real-
a canine ventricular-tachypaced congestive heart failure time PCR quantification of ion channel subunits also had
model and observed downregulation of HCN2 and HCN4 subunit distribution properties typical of SAN: greater mRNA
mRNA.20 The similarities in SAN ionic current changes that expression-levels of HCN2, HCN4, and MiRP1 subunits and
occur with congestive heart failure–induced and ATP-related lower expression levels of Cx43 than RA tissue.20,26
remodeling are striking and may suggest a characteristic SAN Although the present results are compelling evidence for a
ionic current response to pathological insults. A possible contribution of HCN/If downregulation to ATP-induced SAN
explanation for the lack of changes in SAN ICaL and inward- dysfunction, we cannot exclude the possibility that other
rectifier K⫹ currents could be that SAN cells are not fired at changes may contribute as well. We did not study the
such high frequencies as atrial cardiomyocytes during AF, properties of all channels, ion transporters, and ion-handling
owing to SAN slow-channel properties that cause entry block systems in SAN tissue. In particular, there is recent evidence
into the central SAN and limit follow frequencies.21 for an important contribution of sarcoplasmic reticulum Ca2⫹
uptake and release processes to cardiac pacemaking.27 Thus,
Novelty and Potential Significance changes in important components of the cellular Ca2⫹-
The present study is the first of which we are aware to study handling machinery, including, for example, the Na⫹,Ca2⫹
changes in SAN ion channel subunit expression and ionic exchanger, sarcoplasmic reticulum Ca2⫹ ATPase (SERCA),
current function with atrial tachycardia remodeling. Our the ryanodine receptor, calsequestrin, and phospholamban,
results provide novel insights into the fundamental mecha- could have been changed by ATP and could contribute to
nisms at the ionic and molecular level responsible for a altered SAN automaticity. A role for other ionic currents
clinically important phenomenon, the SAN dysfunction that cannot be excluded, including Cl⫺ currents such as the
is associated with atrial tachyarrhythmias. The importance of Ca2⫹-dependent, swelling-induced, and cAMP-regulated Cl⫺
this problem has been underlined in a recent detailed review current; K⫹ currents such as the Ca2⫹-dependent K⫹ current;
of SAN physiology in relation to sick sinus syndrome, with various 2-pore, 4-transmembrane domain channels; and non-
an absence of information about the underlying molecular/ selective cation channels. In addition, adrenergic and cholin-
ionic basis being evident.22 The observation that HCN subunit ergic regulation importantly modify If function and SAN
downregulation underlies SAN dysfunction in the present automaticity. We cannot exclude a role for ATP-related
experimental model of tachycardia-bradycardia syndrome, as changes in autonomic and associated G-protein– coupled
it does in experimental congestive heart failure,19,20 provides regulation of If or other currents controlling SAN function.
further rationale for the development of cell/gene therapy Nevertheless, we have succeeded in identifying congruent
approaches that involve HCN subunit expression enhance- ionic current and channel subunit mRNA changes that are
ment for the management of clinical bradyarrhythmia consistent with previous studies of SAN pathological remod-
syndromes.23 eling and that on the basis of an ion-current– based SAN
The present study is also the first to the best of our mathematical model account for a substantial portion of the
knowledge to study the properties of ionic currents in the SAN slowing that we observed. Finally, although the present
canine SAN. The rabbit has been the species most commonly results implicate HCN/If remodeling in ATP-induced SAN
used for SAN cell isolation and study, but the dog has clear dysfunction, we did not study the underlying molecular
advantages in terms of widespread availability of clinically mechanisms, which would be an appropriate objective for
relevant pathological models. Kwong et al24 isolated cells of future studies.
various morphologies from canine SAN preparations and
described spider- and spindle-shaped cells as having unique Acknowledgments
connexin distribution properties that suggested a primary role The authors thank Nathalie L’Heureux and Chantal St-Cyr for
in pacemaking function. The same group subsequently iso- technical assistance and France Thériault for secretarial support.
lated cells with these morphologies from rabbit SANs and
showed that they have prominent If-like currents, which are Sources of Funding
This study was supported by the Canadian Institutes of Health Research
larger for the spider-type cells.25 In the present study, we
(Award MOP 44365), the Quebec Heart and Stroke Foundation, the
confirmed the prominent If shown by these cell types in Mathematics of Information Technology and Complex Systems (MI-
canine SAN, which contrasts with the lack of If that we noted TACS) Network of Centers of Excellence, and the European-North
in atrial cells. The present studies thus provide further American Atrial Fibrillation Research Alliance (ENAFRA) network
evidence for the pacemaker-cell phenotype specialization of award from Fondation Leducq. Dr Burstein received a Canadian
Institutes of Health Research (CIHR) MD/PhD studentship.
spider and spindle cells in the dog. Further studies of SAN
cell pathophysiology in other canine models of human car-
Disclosures
diac disease would be of potential interest. None.
Potential Limitations References
The SAN origin of isolated cells and tissue preparations is 1. Ferrer MI. The sick sinus syndrome in atrial disease. JAMA. 1968;206:
always difficult to confirm with certainty. We isolated cells 645– 646.
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015Yeh et al SA Node Ion Channels in Tachy-Brady Syndrome 1585
2. Kaplan BM. The tachycardia-bradycardia syndrome. Med Clin North Am. 16. Dobrev D, Graf E, Wettwer E, Himmel HM, Hála O, Doerfel C, Christ
1976;60:81–99. T, Schüler S, Ravens U. Molecular basis of downregulation of
3. Thery C, Gosselin B, Lekieffre J, Warembourg H. Pathology of sinoatrial G-protein-coupled inward rectifying K⫹ current (I(K,ACh) in chronic
node: correlations with electrocardiographic findings in 111 patients. Am human atrial fibrillation: decrease in GIRK4 mRNA correlates with
Heart J. 1977;93:735–740. reduced IK,ACh and muscarinic receptor-mediated shortening of action
4. Kumagai K, Akimitsu S, Kawahira K, Kawanami F, Yamanouchi Y, potentials. Circulation. 2001;104:2551–2557.
Hiroki T, Arakawa K. Electrophysiological properties in chronic lone 17. Dobrev D, Friedrich A, Voigt N, Jost N, Wettwer E, Christ T, Knaut M,
atrial fibrillation. Circulation. 1991;84:1662–1668. Ravens U. The G protein-gated potassium current IK,ACh is constitutively
5. Elvan A, Wylie K, Zipes DP. Pacing-induced chronic atrial fibrillation active in patients with chronic atrial fibrillation. Circulation. 2005;112:
impairs sinus node function in dogs: electrophysiological remodeling. 3697–3706.
Circulation. 1996;94:2953–2960. 18. Cha TJ, Ehrlich JR, Chartier D, Qi XY, Xiao L, Nattel S. Kir3-based
6. Sparks PB, Jayaprakash S, Vohra JK, Kalman JM. Electrical inward rectifier potassium current: potential role in atrial tachycardia
remodeling of the atria associated with paroxysmal and chronic atrial remodeling effects on atrial repolarization and arrhythmias. Circulation.
flutter. Circulation. 2000;102:1807–1813. 2006;113:1730 –1737.
7. Hocini M, Sanders P, Deisenhofer I, Jais P, Hsu LF, Scavee C, Weera- 19. Verkerk AO, Wilders R, Coronel R, Ravesloot JH, Verheijck EE. Ionic
soriya R, Raybaud F, Macle L, Shah DC, Garrigue S, Le Metayer P, remodeling of sinoatrial node cells by heart failure. Circulation. 2003;
Clementy J, Haissaguerre M. Reverse remodeling of sinus node function 108:760 –766.
after catheter ablation of atrial fibrillation in patients with prolonged sinus
20. Zicha S, Fernández-Velasco M, Lonardo G, L’Heureux N, Nattel S. Sinus
pauses. Circulation. 2003;108:1172–1175.
node dysfunction and hyperpolarization-activated (HCN) channel subunit
8. Nattel S, Maguy A, Le Bouter S, Yeh YH. Arrhythmogenic ion-channel
remodeling in a canine heart failure model. Cardiovasc Res. 2005;66:
remodeling in the heart: heart failure, myocardial infarction, and atrial
472– 481.
fibrillation. Physiol Rev. 2007;87:425– 456.
21. Kirchhof CJ, Allessie MA. Sinus node automaticity during atrial fibril-
9. Yue L, Feng J, Gaspo R, Li GR, Wang Z, Nattel S. Ionic remodeling
lation in isolated rabbit hearts. Circulation. 1992;86:263–271.
underlying action potential changes in a canine model of atrial fibrillation.
22. Dobrzynski H, Boyett MR, Anderson RH. New insights into pacemaker
Circ Res. 1997;81:512–525.
10. Kurata Y, Hisatome I, Imanishi S, Shibamoto T. Dynamical description activity: promoting understanding of sick sinus syndrome. Circulation.
of sinoatrial node pacemaking: improved mathematical model for primary 2007;115:1921–1932.
pacemaker cell. Am J Physiol Heart Circ Physiol. 2002;283: 23. Robinson RB, Brink PR, Cohen IS, Rosen MR. If and the biological
H2074 –H2101. pacemaker. Pharmacol Res. 2006;53:407– 415.
11. Satoh H. Sino-atrial nodal cells of mammalian hearts: ionic currents and 24. Kwong KF, Schuessler RB, Green KG, Laing JG, Beyer EC, Boineau JP,
gene expression of pacemaker ionic channels. J Smooth Muscle Res. Saffitz JE. Differential expression of gap junction proteins in the canine
2003;39:175–193. sinus node. Circ Res. 1998;82:604 – 612.
12. Zupan I, Kozelj M, Butinar J, Rakovec P. Impaired sinus node function 25. Wu J, Schuessler RB, Rodefeld MD, Saffitz JE, Boineau JP. Morpho-
and global atrial conduction time after high rate atrial pacing in dogs. Cell logical and membrane characteristics of spider and spindle cells isolated
Mol Biol Lett. 2002;7:383–384. from rabbit sinus node. Am J Physiol Heart Circ Physiol. 2001;280:
13. Van Wagoner DR, Pond AL, Lamorgese M, Rossie SS, McCarthy PM, H1232–H1240.
Nerbonne JM. Atrial L-type Ca2⫹ currents and human atrial fibrillation. 26. Yu H, Wu J, Potapova I, Wymore RT, Holmes B, Zuckerman J, Pan Z,
Circ Res. 1999;85:428 – 436. Wang H, Shi W, Robinson RB, El Maghrabi MR, Benjamin W, Dixon J,
14. Bosch RF, Zeng X, Grammer JB, Popovic K, Mewis C, Kühlkamp V. McKinnon D, Cohen IS, Wymore R. MinK-related peptide 1: a beta
Ionic mechanisms of electrical remodeling in human atrial fibrillation. subunit for the HCN ion channel subunit family enhances expression and
Cardiovasc Res. 1999;44:121–131. speeds activation. Circ Res. 2001;88:E84 –E87.
15. Van Wagoner DR, Pond AL, McCarthy PM, Trimmer JS, Nerbonne JM. 27. Lakatta EG, Vinogradova TM, Maltsev VA. The missing link in the
Outward K⫹ current densities and Kv1.5 expression are reduced in mystery of normal automaticity of cardiac pacemaker cells. Ann N Y Acad
chronic human atrial fibrillation. Circ Res. 1997;80:772–781. Sci. 2008;1123:41–57.
CLINICAL PERSPECTIVE
Sinoatrial node dysfunction is frequently associated with atrial tachyarrhythmias, and patients with the combination are said
to suffer from the relatively common tachycardia-bradycardia syndrome. Abnormalities in sinus node pacemaker function
on termination of atrial tachyarrhythmias such as atrial fibrillation can cause syncope and require pacemaker implantation,
but the underlying mechanisms remain poorly understood. There is evidence from clinical and experimental studies that
suggests that a significant component of sinus node dysfunction in patients with the tachycardia-bradycardia syndrome may
actually be caused by supraventricular tachyarrhythmia and may be reversible if the tachyarrhythmia is controlled. The
present study examined the hypothesis that very rapid atrial tachyarrhythmias can cause ion channel downregulation in the
sinus node, thereby causing abnormal sinus node function. Dogs subjected to atrial tachypacing at 400 bpm for 7 days
showed prolonged sinus node recovery time, which indicates sinus node dysfunction. Ion channel subunit messenger RNA
expression was measured in sinus node tissue and showed downregulation by atrial tachycardia of 2 specific types of
subunits: Those underlying the funny current, which is known to be particularly important in cardiac pacemaking activity,
and an accessory subunit involved in the slow delayed-rectifier K⫹ channel. Patch-clamp studies on sinus node cells
isolated from control dogs and dogs subjected to atrial tachypacing confirmed the specific downregulation of funny current
and slow delayed-rectifier K⫹ current with atrial tachycardia. These alterations were incorporated in a mathematical model
of sinus node electrical activity, which suggested that the funny current changes were the principal factor in sinus node
suppression by atrial tachycardia. Our results provide insights into the molecular mechanisms underlying clinically
significant bradycardic complications of this common and important clinical syndrome.
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015Online Figure I.
Supplemental Material
A. B.
SAN
SAN
m
40 μm 40 μm
Representative spindle-like (A) and spider-like (B) SAN cells. SAN cells are labelled
“SAN”. An atrial cardiomyocyte is seen for reference in panel A and is labelled “m”.Online Figure II.
A. B.
Baseline After 1 mM barium
2 sec
-40 mV
500 pA
-140 mV
500 ms
Atrium (n=10 cells/3 dogs)
C. Barium-sensitive current D. SAN (CTL,n=9 cells/3 dogs)
SAN (ATP, n=13 cells/4 dogs)
2
Current density (pA/pF)
200 pA
0
-125 -100 -75 -50 -25 0
500 ms -2
-4
-6
-8
Hyperpolarization-activated currents in SAN cells were Ba2+-insensitive. Recordings from an SAN cell are shown before (A)
and after (B) Ba2+ superfusion (1 mmol/L). Digitally-subtracted Ba2+-sensitive currents are shown in C, and mean current-
voltage relations for the Ba2+-sensitive currents in SAN-cells are contrasted with currents in atrial cardiomyocytes in D.
Studies were also performed with SAN-cells isolated from AT-P dogs, with mean data indicated by the triangles.Funny Current Downregulation and Sinus Node Dysfunction Associated With Atrial
Tachyarrhythmia: A Molecular Basis for Tachycardia-Bradycardia Syndrome
Yung-Hsin Yeh, Brett Burstein, Xiao Yan Qi, Masao Sakabe, Denis Chartier, Philippe Comtois,
Zhiguo Wang, Chi-Tai Kuo and Stanley Nattel
Circulation. 2009;119:1576-1585; originally published online March 16, 2009;
doi: 10.1161/CIRCULATIONAHA.108.789677
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2009 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/119/12/1576
Data Supplement (unedited) at:
http://circ.ahajournals.org/content/suppl/2009/03/13/CIRCULATIONAHA.108.789677.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/
Downloaded from http://circ.ahajournals.org/ by guest on May 23, 2015You can also read